Hybridization And Southern Blots

1. Hybridization And Southern Blots Timothy G. Standish, Ph. D.

2. Hybridization • The bases in DNA will only pair in very specific ways: G with C and A with T • In short DNA sequences, imprecise base pairing will not be tolerated • Long sequences can tolerate some mispairing only if hydrogen bonding of the majority of bases in a sequence exceeds the energy required to overcome mispaired bases • The source of any single strand of DNA is irrelevant, merely the sequence is important, thus complimentary DNA from different sources can form a double helix • This phenomenon of base pairing of single-stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands from different sources

3. DNA from source “X” CTGATGGTCATGAGCTGTCCGATCGATCAT TACTCGACAGGCTAG Hybridization TACTCGACAGGCTAG DNA from source “Y” Hybridization

4. Hybridization • Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way, much information can be gained about unknown DNA using single-stranded DNA of known sequence • Short sequences of single-stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: • Southern blots • Northern blots (in which RNA is probed) • In situ hybridization • Dot blots . . . • In addition, the renaturation, or hybridization, of DNA in solution can tell much about the nature of organism’s genomes

5. Library Screening • The most common method of library screening involves hybridization of probes to target DNA • Hybridization refers to the specific way DNA sequences base pair with their exact compliment • Probes – Single-stranded nucleic acids used to hybridize with a target DNA. Generally probes are radioactive or marked in some other way so that they can easily be identified after binding to target DNA • To design probes for hybridization screening, something must be known in advance about the target sequence

6. Hybridization Screening • Takes advantage of the fact that complimentary strands of DNA can recognize one another • By sticking DNA from many colonies or plaques in a library to a membrane • Making the DNA single stranded • Then hybridizing a probe to the DNA on the membrane thus marking target DNA on the membrane, colonies or plaques containing the target DNA can be identified

7. Transfer cells to membrane Membrane Lyse cells - DNA and protein stick to membrane Locate colony with target clone Block membrane - Prevents probe from sticking to membrane Develop X-ray film Add probe Cover with X-ray film Wash off excess probe Hybridization Screening

8. Southern Blots • Called Southern blots after their inventor • Involve four steps: • Digestion of DNA using restriction enzymes • Separation of the DNA fragments by size using gel electrophoresis • Transfer of fragments to a nitrocellulose or nylon membrane • Hybridization of a probe to the fragment or fragments of interest • Probe detection (autorad development)

9. 1 2 3 1 2 3 Marker Control Experimental Making A Southern Blot 1 + 2 Digestion and Electrophoresis

10. Paper Towels Gel Membrane Membrane Gel Buffer Making A Southern Blot 3DNA Transfer To Membrane DNA

11. Addition of blocking reagent Probe addition After washing Membrane with bound DNA Parts of the membrane not already covered with DNA now bind blocking reagent Probe covers the membrane, but only binds to complimentary DNA Probe only remains annealed to complimentary DNA Making A Southern Blot 4Probe Hybridization

12. Membrane with probe bound to complimentary DNA X-ray film is placed over the membrane and left until radiation from the probe has exposed the film Fragments complimentary to the probe appear as bands on the autorad Making A Southern Blot 5Autorad Development

13. So What is the Big Deal? • Southern blots tell both the size and something about the sequence of a fragment mixed in with many other fragments, thus they can be used for many purposes • RFLPs - Restriction Fragment Length Polymorphisms - When mutations change the size of specific sequences in the genome, they may be identified by a change in the size of a RE digested fragment identified using a Southern blot • RFLPs - Can be correlated to specific genetic defects thus allowing diagnosis of genetic disease • RFLPS - Are used as genetic markers in mapping genes • Some parts of DNA called Variable Number Tandem Repeats (VNTRs) are highly polymorphic (variable) in length and can be used for genetic fingerprinting

14. Victim Under Nails Suspect 1 Suspect 2 A VNTR Probe was used to make this DNA fingerprint Using DNA Fingerprinting • A murder victim is found to have human tissue under his fingernails having, during the course of struggle, managed to scratch his murderer • Two suspects have been identified as having a motive and suspicious scratches on their faces: • Suspect 1 - The victims wife • Suspect 2 - The wife’s boyfriend

15. Does This Prove The Boyfriend Did It? • Not exactly • DNA fingerprinting is very good for elimination of suspects. Thus the wife’s tissue was not under her husband’s fingernails • That the tissue under the husband’s fingernails was the murderer’s is an assumption • There are other plausible scenarios including - The husband and boyfriend were fighting, the wife came home and shot her husband to protect her boyfriend • The boyfriend’s DNA matches tissue under the victims nails; while this eliminates millions of other people it does not prove it is actually his tissue

16. Paternal Grandmother Maternal Grandfather Maternal Grandmother Paternal Grandfather Father Mother Child DNA Fingerprinting Can Show Relationships • During the 1970s and 80s a “dirty war” was fought in Chile directed by General Pinochet • Many people disappeared and their children were adopted by innocent people • These children have been reunited with their grandparents using DNA fingerprinting

17. The End