240 likes | 252 Views
Friday, February 19 th , 2016. La gestione personalizzata delle malattie infettive. Chiara Azzari Pediatric Immunology Division University of Florence Anna Meyer Children Hospita l Jeffrey Modell Center for Immunodeficiencies. Marco, 18 years old Fever,
E N D
Friday, February 19th, 2016 La gestione personalizzata delle malattie infettive Chiara Azzari Pediatric Immunology Division University of Florence Anna Meyer Children Hospital Jeffrey Modell Center for Immunodeficiencies
Marco,18 years old Fever, High white blood cell count: (WBC=72.000) After 6 hours: Shock, Coma, death. Culture analyses:NEGATIVE infective hypothesis was not considered Diagnosis: acute leukemia
POSITIVE NEGATIVE time (hours) after antibiotic treatment The culture methods requires large volume samples Culture method is considered the gold standard, however... the time required to sterilize the cerebrospinal fluid (CSF) of children affected by meningococcal meningitis (MM).
After 3 days, younger brother, Giulio, 12 years old Fever, poor clinical conditions What is the cause of the death of Marco? Leukemia or sepsis? Realtime PCR (postmortem specimens): meningococcus type C
Rate of culture-positivity in invasive meningococcal infection (all cases were positive with RT-PCR) Among 55 CSF samples positive with RT-PCR, 22/55 (38,6%) were positive in culture too (McNemar’s p < 10-3 ) Among 43 blood samples (positive with RT-PCR), 11/43 (25,6%) were positive in culture too (McNemar’s p < 10-3) Azzari, Nieddu et al., 2014
What is the rate of culture underestimation for the Meningoccoccal infections? Azzari, Nieddu et al., Vaccine 2014
SIMI – ISS Data PCR Data What are the real figures for meningococcus invasive disease in Italy?
4,7 3,6 11,2 11,5 <2 <5 <14 <1 Incidenceof invasive pneumococcal disease among children COLTURE-BASED METHOD 60 50 40 30 Cases x 100.000 20 10 0 Years old Azzari C, et al J Med Microbiol 2008
55,8 51,8 35,1 19,9 <2 <5 <14 <1 Incidenceof invasive pneumococcal disease among children MOLECULAR METHOD 60 50 40 Cases x 100.000 30 20 10 0 Years old Azzari C, et al J Med Microbiol 2008
Center for Disease Control, Atlanta, USA
47 meningococcus 24 pneumococcus PCR 4 HI nt Culture 7 S. agalactiae 72 8 Others 90 25 6 32 9 1 salmonella 2 S.aureus 2pneumococcus 1 pseudomonas In 43 / 90 cases (48%) chemoprophylaxis was useless. not determined Meningococcus Pneumococcus S. agalactiae HI nt others PCR vs Culture - 159 bacterial meningitidis 56 Azzari, Nieddu et al., Vaccine 2014
We work for every single patient but we are also part of Public Health
Meningitis clusterTuscany 2015 January 6th 2015 23 cases Jan-April 38 cases in 2015 33 C (8 deaths) 4 B 1 W A hypervirulent clone?
A B C W135 Y The capsule can be: Invasivity and virulence is dependent on subcapsular proteins Capsular Polisaccharide (antigene self) N.meningitidis
Subcapsular protein sequence Which vaccination campaign? The “mix” of subcapsular proteins identifies the hypervirulent clone ST11 Capsule: C, subcapsular proteins: ST11
The decision is: vaccination with tetravalent A,C.W.Y meningococcal vaccine Neisseria meningitidis (as other bacteria) is able to share part of genetic material (as capsule gene) with other. A hypervirulent ST11 with capsule C can become a Hypervirulent ST11 with capsule Y or W.
We work for every single patient Butwe are also part of Public Health And webase aware and sustainabledecisions on ourdata
no amplification Carlo, 16 years old Pharyngitis bilateral pneumonia, bilateral empyema bone abscesses , purulent fluid surrounding the pelvic organs Realtime PCR panels:
The 16S rRNA gene is universal in bacteria with sufficient interspecific polymorphisms the comparison of the 16S rRNA gene sequences allows differentiation between organisms
Lemierre's syndrome Realtime PCR panels: no amplification specific antibiotics and Hyperbaric treatment Carlo, 16 years old Fusobacterium necrophorum Pharyngitis bilateral pneumonia, bilateral empyema bone abscesses , purulent fluid surrounding the pelvic organs
If a 1000 bp sequence (330 aa) belongs to a sufficently variable gene, the answer will be unequivocable
I have a dream, that my four little children will one day live in a nation where they will not be judged by the color of their skin but by the content of their character. I have a dream today! One day right there in Alabama little black boys and little black girls will be able to join hands with little white boys and white girls as sisters and brothers. I have a dream today! Martin Luther King Jr. August 28, 1963 300 characters ATTCGGTCGTACTGCATTGGCTAC……
Pediatric Immunology Division University of Florence - A.Meyer Children’s Hospital Jeffrey Modell Center for Immunodeficiencies