Sequencing the Euchromatic Region of Chromosome 5 of Tomato

1. Sequencing the Euchromatic Region of Chromosome 5 of Tomato

2. International Tomato Genome Sequencing Project Country USA Korea China UK India NL France Japan Spain USA USA Italy 1 2 3 4 5 6 7 8 9 10 11 12 Chromosome Mb 24 26 26 19 12 20 27 17 16 10 13 11 T=220 To sequence BACs 246 268 274 193 111 213 277 175 164 108 135 113 T=2276 0 µm 53.8 Mb 64.7 Mb 64.7 Mb 80.0 Mb 82.1 Mb 80.3 Mb 81.8 Mb 76.4 Mb 83.6 Mb 85.6 Mb 88.5 Mb Euchromatin 108.0 Mb Heterochromatin 70 µm

3. National Research Centre for Plant Biotechnology National Institute for Plant Genome Research Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad Debasis Chattopadhyay Sabhyata Bhatia Indian Initiative on Tomato Genome Sequencing Telomeric Region University of Delhi South Campus Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma Euchromatic Region UDSC & NIPGR (0-60 cM) Heterochromatic Region Centromeric Region Heterochromatic Region NRCPB (69-119 cM) Euchromatic Region Telomeric Region

4. Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker:CT101 Seed BAC:LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2:TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82) L. esculentum L. pennellii IL 5-1 IL 5-2 IL 5-3 IL 5-4 IL 5-5

5. Confirmation of ten nucleation points (markers) on chromosome 5-specific IL lines

6. Mapping of BAC clones on chromosome 5 using FISH Chromosome 5 0 cM UDSC + NIPGR 30 cM BAC: LE_HBa0189E17 Marker: T0564 at 11 cM 60 cM 90 cM NRCPB BAC: LE_HBa0138J03 Marker: T1746 at 84 cM 119 cM

7. The path for genomic sequencing Single streak of BAC clones from seed BAC library DNA extraction DNA fingerprinting (HindIII-digested) for BAC stock purity CHEF-analysis for size estimation PCR with genetic marker for re-confirmation IL-mapping for chromosome 5-specificity presence of SNP/indels Polymorphism in PCR (digested) products Haplotype 1 TACGTG...TTAT 2 CGAACAI/DGACA 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1 Shotgun cloning and sequencing Assembly of sequence BAC annotation Selection of extension BAC Searching for STCs (Sequence Tag Connector) SGN end-sequence database Overgo hybridization

8. Status Clones selected Marker cM Phase III LE_HBa0191B01 CT101 0 Phase II SL_MboI0050C14 Telomeric Region Phase I SL_MboI0004P04 T1181 0 Phase II SL_EcoRI0101I15 T1632 0 Phase III SL_MboI0005B15 Phase III SL_EcoRI0086I08 Phase III LE_HBa0261K11 C2_At1g60200 7 Phase III LE_HBa0042B19 cLET-8-B23 10 Phase II LE_HBa0189E17 T0564 11 Euchromatic Region Phase I SL_MboI0079D24 Short Arm Phase I LE_HBa0115F01 Phase II SL_MboI0095J08 UDSC & NIPGR Phase III SL_MboI0037H06 Phase II LE_HBa0179E24 cLED-8-G3 15.5 Phase III LE_HBa0058L13 CT242 Phase III LE_HBa0060G21 T1592 16 Phase II SL_EcoRI0066O01 TG441 Phase III LE_HBa0145P19 TG432 Phase III LE_HBa0003C20 BS4 44 Phase III LE_HBa0168M18 CT167 Heterochromatic Region Library SL_MboI0118J18 Phase III SL_EcoRI0028N03 Phase III SL_EcoRI0122H05 Phase II LE_HBa0309L13 C2_At2g01110 37 Phase II SL_EcoRI0037P02 Centromeric Region Phase II C2_At3g55120 44 SL_EcoRI0082N07 Phase I SL_MboI0115G01 C2_At4g24830 51 57 Phase I SL_MboI0079C22 T1640 LE_HBa0057G22 Phase II 60 TG96 Phase II LE_HBa0298C03 73 Heterochromatic Region Phase I LE_HBa0169M21 T1360 Library LE_HBa0201O22 Library LE_HBa0135A02 C2_At1g10500 76 Library LE_HBa0009H01 Phase II LE_HBa0138J03 T1746 84 Library SL_MboI0093K24 Long Arm Library SL_EcoRI0015E23 CT172 Library SL_EcoRI0065K15 C2_At2g31970 Library SL_MboI0018L12 Phase II LE_HBa0166A02 T1777 105 NRCPB Phase II LE_HBa0040C21 T1541 107 Phase II LE_HBa0025A19 Euchromatic Region Phase II LE_HBa0131D04 T1584 108 Phase II LE_HBa0196G23 Phase II LE_HBa0141A12 Phase II LE_HBa0239D11 CT130 115 Phase I SL_EcoRI0019P03 Phase II LE_HBa0251J13 TG185 119 Library LE_HBa0089M06 Phase II LE_HBa0076P16 CT138 119 Library LE_HBa0056N10 Telomeric Region Sequencing status of BAC clones from short arm of chromosome 5

9. BAC sequence available in GenBank with keywords TOMGEN, ITAG Repeat Masking and removal of contaminants STRUCTURAL Gene predictions by FGENESH,GeneMark,GlimmerHMM Alignments with ESTs EuGene Unified gene models InterPro, BLASTP, GO Batch001 (10 BACs) Batch002 (57 BACs) FUNCTIONAL SwissProt V52 TAIR V6 RAP- db Build4 first significant hit (<e-5) Outputs uploaded in gff3 and txt file formats Annotation of tomato genome

10. Highlights 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 2. Presently, 51 BAC clones, covering approximately ~4.6 Mb region, have been mapped and are in the sequencing pipeline 3. Current status of BAC clones from chromosome 5, selected for sequencing * Thirteen BAC clones in phase III (8 submitted to NCBI) * Twenty BAC clones in phase II (10 submitted to NCBI) * Eight BAC clones in phase I * Ten BAC clones at various stages of library preparation and sequencing 4. Of the ten BAC clones sent for FISH at Stephen Stack’s laboratory, Colorado, seven have been mapped on Chromosome 5 5. Novel CAPS markers are being used to map BACs that have been selected on the basis of ORFs at both ends 6. Functional annotation of proteins predicted by Eugene is being carried out as a participating member of ITAG

11. Designing primers from either/both BAC ends PCR amplification from S. pennellii and S. lycopersicum Sequencing of S. pennellii PCR amplified product Comparison for SNPs Designing CAPS marker PCR amplification from parents and chromosome-wise IL pools Restriction digestion of PCR product from parents and 12 chr. IL pools Validation by individual ILs from specific chromosome Procedure for the confirmation of BACs on tomato chromosomes using CAPS markers in Introgression Lines

12. 100 bp ladder S. lycopersicum S. pennellii Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 Chromosome 12 1 kb ladder 100 bp ladder S. lycopersicum S. pennellii Chromosome 1 Chromosome 2 Chromosome 3 Chromosome 4 Chromosome 5 Chromosome 6 Chromosome 7 Chromosome 8 Chromosome 9 Chromosome 10 Chromosome 11 Chromosome 12 1 kb ladder Confirmation of a BAC clone HBa0024M22 on tomato chromosome 5 using ILs Digestion of PCR amplified products with Eco RV

13. New BACs mapped on tomato chromosomes using CAPS markers

14. Contributors IITGS UDSC NRCPB NIPGR Prof. Akhilesh K. Tyagi Prof. J. P. Khurana Prof. P. Khurana Dr. A. K. Sharma Dr. Vikrant Gupta  Dr. Saloni Mathur Dr. Shailendra Vyas Mr. Amol Solanke Mr. Rahul Kumar Ms. Rashmi Jain Mr. Rupesh K Jain Mr. Shaji Joseph V Dr. Nagendra K. Singh Dr. T. Mohapatra Dr. T. R. Sharma Dr. K. Gaikwad Dr. Kamlesh Batra Dr. Archana Singh  Dr. Mahavir Yadav  Dr. Rekha Dixit  Dr. Pradeep K. Singh  Mr. Vivek Dalal  Ms. G. Chitra Mr. Awadhesh Pandit Mr. Sambit P. Sahoo  Mr. Shashi B. Ojha Dr. Debasis Chattopadhyay Dr. Sabhyata Bhatia Dr. S. Dewan Ms. P. Chowdhury S. Shridhar

15. Criteria for BAC selection and confirmation • Selection of two candidate seed BACs on chromosome 5 • specific marker • 100 kb or more in size • end sequence availability at SGN • 2. Purity check of bacterial stock • Hind III fingerprint of DNA isolated from six independent colonies • 3. PCR amplification of genetic markers/overlapping region • two marker/overlapping region-specific primer pairs • 4. BAC verification by direct sequencing • using two marker/overlapping region-specific primers • using vector-specific SP6 and T7 primers • 5. Size estimation/confirmation of BAC clone • by CHEF analysis of Not I digested BAC DNA • 6. Validation of BAC on chromosome 5 using Introgression Lines • polymorphism in PCR products • SNP detection of non-polymorphic bands

16. BACs mapped on chromosome 7 Chromosome 7 SP6 SP6 SP6 SP6 T7 HBa0144B20 HBa0123J08 HBa0064M20 HBa0102G23 HBa0188L22 SP6 Primer pair 1 ~1.4 kb overlap SP6 Primer pair 2 ~3.5 kb overlap T7 T7 T7 T7 MboI0077G20 (92 kb) SP6 T1401 (COS) 95 cM Primer pair 1 12955 bp overlap (100%) CT223 (RFLP) T7 HBa0179K09 (108 kb) T7 Primer pair 1 9002 bp overlap (100%) Clones sequenced to Phase III level T7 Clones sequenced to Phase II level MboI0032F07 (~140 kb) SP6 Extension clones verified T7 Red bars indicate the PCR positive nature of BAC clones using respective primer pairs ~19 kb overlap Primer pair 2 ~15.5 kb overlap Primer pair 1 SP6 Dotted line indicates the expected overlap MboI0052O23 MboI0083J01 Blue line shows the presence of mapped markers on the BAC clones SP6 T7

17. Reallocation of marker T0876 and its associated BAC positions on chromosome 7

18. Confirmation of BAC position on chromosome 5 using Introgression Lines Designing primers from marker or BAC-specific sequences PCR amplification from genomic DNA of L. esculentum, L. pennellii and ILs of chromosome 5 Exo-SAP treatment to amplified PCR product Sequencing of PCR products with both Forward and Reverse primers Alignment of generated sequences Search of SNPs/InDels in ILs with respect to parents

19. Gene prediction & annotation of some sequenced BAC clones

20. Annotation of some sequenced BAC clones

21. Important genes present on some BAC clones