140 likes | 233 Views
Chapter 11 Academic Chapter 9 Honors. Text book Notes. 12-1. TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) How did we find out that this happens…?. 1928 Griffith: British scientist. Prob? How do bacteria make people sick?
E N D
Chapter 11 AcademicChapter 9 Honors Text book Notes
12-1 • TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) • How did we find out that this happens…?
1928 Griffith: British scientist • Prob? How do bacteria make people sick? • Specifically the bacteria pneumonia… • Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B) • Results : (what do you think will happen- which bcateria will kill the mice?)
12-3 RNA & Protein Synthesis • Synthesis? • DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCCCGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG • Code controls the making of proteins (which control traits: ex blood type, flower color ) • QUESTION OF THE DAY: • How can we decode that message?
Decode Message • Message needs to go from nucleus to ribosomes….
Meet the RNA family … • mRNA travels to ribosomes • rRNA is present at the ribosomes • tRNA- transfers the amino acids to the ribosomes
Transcription • Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand • Step 2: mRNA looks only for the section that it needs to copy • Step 3: mRNA finds the section and copies it but in its own complementary language • Step 4: mRNA goes to Ribosome with message
Translation • Step 1: mRNA arrives at the ribosome, and rRNA is already there waiting…. • Step 2: mRNA and rRNA show the section of the code in codons in (mRNA language) to all the present tRNA’s • Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid. • Step 4: After a bunch of amino acids line up- proteins are made….
http://www.youtube.com/watch?v=983lhh20rGY • Video transcription and translation • Video replication • http://www.youtube.com/watch?v=hfZ8o9D1tus&feature=related