MUTANTS genetic variation in human development Lecture 6 Fall 2006 Bennington College

1. MUTANTSgenetic variation in human developmentLecture 6Fall 2006Bennington College

2. HOMEOTIC GENES homeotic genes all have a common amino acid sequence that confers the necessary structure to bind to DNA and activate or repress gene transcription - this sequence is called the homeobox homeotic genes specify the particular developmental fate of body parts example: "build mouthparts here (and not everywhere)", and "put genitalia here (not over there)"

3. HOMEOTIC GENES Homeobox and Homeodomain: The homeobox is a 180 base pair sequence of DNA found in many regulatory genes. The homeodomain is the 60 amino acid stretch that corresponds to the translated homeobox. This part of the protein is the DNA binding sequence. DNA consists of 4 possible bases/nucleotides - GCAT A sequence of DNA is read 3 bases at a time when being converted to amino acids (and ultimately protein) for a given DNA sequence: ATGCCGCATCCAAGGGTCGACGTATTTCTTGTGGATCATCGGAGACGA TACGGCGTAGGTTCCCAGCTGCATAAAGAACACCTAGTAGCCTCTGCT would be the transcribed mRNA sequence and M P H P R V D V F L V D H R R R is the resulting sequence of amino acids

4. Translation of messenger RNA into protein Amino Acid tRNA anti-codon mRNA codon

5. HOMEOTIC GENES To initiate gene expression (or in some cases, to prevent gene expression), regulatory proteins (homeobox proteins and other transcription factors) bind to DNA upstream of the start of the target gene at regulatory elements.

6. the homeodomain helix 3 likes to bind to TAAT HOMEOTIC GENES The homeodomain region of homeotic genes folds into three helices formed such that helix 3 fit perfectly into a groove formed by the DNA spiral, and the amino acids in homeodomain regions specify binding to particular sequences in the DNA.

7. HOMEOTIC GENES The homeodomain sequence is highly conserved. The DNA sequence is roughly 75% homologous when comparing different Hox genes within the fly; comparisons of just the homeodomain sequence show even higher homology (most nucleotide differences conserve the amino acid encoded)

8. HOMEOTIC GENES Q (glutamine) K (lysine)

9. CLEPPIES • The prevailing myth that human deformity • results from some moral failing • “mark of Cain” philosophy… • With our modern scientific knowledge, • clearly has no basis in fact - but sometimes • events conspire to make you wonder…

10. CLEPPIES The 1680’s in Scotland came to be known as “The Killing Time” England, following up on what King Charles II started, was still trying to impose the English Church system on Scotland. Dissenters were not tolerated and were put to death - often in spectacular and horrific fashion (to, of course, discourage other potential dissenters…) Thus was the fate of elderly Margaret McLauchlan and youthful Margaret Wilson (her younger sister would have suffered the same fate but her life was purchased) it was demanded of them, as a test of their loyalty, that they should swear the abjuration oath. This was an oath rejecting a manifesto published by the Society People, or the Cameronians, on the 8th of November 1684, entitled 'The Apologetic Declaration and Admonitory Vindication of the True Presbyterians of the Church of Scotland, especially anent Intelligencers and Informers.' Sentenced to death by “drowning at the stake”

11. CLEPPIES Supposedly, the officer who last thrust the younger Margaret into the waters was named Bell. His wife soon thereafter gave birth to a child with ectrodactyly (split-hand split-foot syndrome) his descendants thus came to be known as the “cleppie Bells” (why not parten Bells? I need a linguist to explain this to me…)

12. CLEPPIES Ectrodactyly is dominantly inherited but can also be chemically induced (at least in rats) by environmental factors: retinoic acid, cadmium, hydroxyurea, cytarabine, methotrexate, ethanol, caffeine, cocaine, valproic acid, acetazolamide and methoxyacetic acid

13. Ectrodactyly is only one of many possible things that can go wrong during limb development well-formed limbs are not essential for viability (and are quite easily compensated for - especially if they were never there to begin with)

14. Acheiropodia Ianakiev,P. et al., Acheiropodia Is Caused by a Genomic Deletion in C7orf2, the Human Orthologue of the Lmbr1 Gene, Am. J. Hum. Genet., v.68: 38-45, 2001.

15. phocomelia (tetraphocomelia)

16. Phamous Phocomelia-ites Carl Hermann Unthan born in East Prussia 1848-1928

17. Phamous Phocomelia-ites Marc Cazotte (Pepin) born in Paris 1757-1801

18. Limb development - Buds, bones, and beyond… Day 28 Day 26

19. Day 26 Day 28

20. the limb bud is capped with cells comprising an Apical Ectodermal Ridge (AER) - discovered by John Saunders in 1948

21. The AER is rich in signalling molecules - especially FGFs FGF = Fibroblast Growth Factor = A family of protein growth factors involved in new blood vessel formation, wound repair, lung maturation, and the development of skeletal muscle, specific lineages of blood cells and bone marrow. FGFs are recognized by a family of cell surface receptors that have the ability to catalyze reactions inside the cell after they are activated by the FGFs.

22. Effects of mucking about with the AER

23. Induction of ectopic limb with FGF-soaked bead

24. CLEPPIES Pascal H.G. Duijf, Hans van Bokhoven* and Han G. Brunner Pathogenesis of split-hand/split-foot malformation Human Molecular Genetics, 2003, Vol. 12, Review Issue 1 R51-R60 Figure 1. The ectrodactyly phenotype and underlying AER defect. (A) Clinical variability of ectrodactyly. (B) Normal development of the autopod (top) and ectrodactyly malformation (bottom). Ectrodactyly is caused by a failure to maintain median AER activity (red) in the developing limb bud (left), leading to the absence of the central rays (right). (Future) positions of digits 1–5 are indicated. AER, apical ectodermal ridge; PZ, progress zone; ZPA, zone of polarizing activity.

25. For correct limb and digit development, three specialized cell clusters are of primary importance: the apical ectodermal ridge (AER), the progress zone (PZ), and the zone of polarizing activity (ZPA). These groups of cells produce signalling molecules that determine the fate of neighbouring cells by instructing them to remain undifferentiated, to proliferate, or to differentiate into a particular cell type.

26. CLEPPIES

27. effects of thalidomide on human fetus development

28. Thalidomide effects on fetal marmosets on the right, fetus of a marmoset treated with 25 mg/kg body weight thalidomide between days 38 and 46 of pregnancy