Testing Promoter Activity in the Cnr 2 Gene Upstream of Exon IB Allison G. Norrod and Robyn A. Puffenbarger

1. Figure 3 Transcription Factor Binding Sites5 319 Piece DNA Sequence • 1 GTGTTAGCAG ACAGCAGAAC TGGAATTAAA GACAGCTATG AGCTGCTATT • 51 TGAGTTCTGGGAACCAAACC CCAGTTCCCT GCAAGAACGG CCAGTGTTGT • 101 TAATCTCTAA ACCATCTCTT CCAGCCCCAT GCATTTGGTG TGTGTGTGTG • 151 TGTGTGTGTG TGTGTGTACT ATTAATTGCT TTTGAGACAG GGTCTCACTA • 201 TGTAGCTGGC CAGGAACTTG CCACATAGAA CAGGCTGTCC TCAGACTCAT • AGAGATCTAG CTGCCTCTGTTTCCCATGTG CTAAGATTAA AGCTGTGTGC • 301 CACCATAGCA AGCTGGAAAG Consensus STAT5 Binding Site: TTT _ _ _ GAA Consensus NF-κB Binding Site: GGG ACT TTC C Compliment DNA Strand: CCC TGA AAG G Figure 4 Promoter Activity 610 bp 849 bp 25 20 15 Fold-Over Negative Control 10 Figure 1 Mouse Chromosome 4, Cnr 2 gene organization4 5 0 1B 2 1A Cnr 2-1 Cnr 2-2 *not to scale Acknowledgements & References • This research was supported by the Thomas F. and Kate Miller Jeffress Memorial Trust, grant number J-676. I would like to thank Michael Donovan and Erin Spadaro. Also, I would like to thank Dr. Jon Kastendiek and the James Madison University department of Biology for donating the use of their poster printer. • Sim L., Hampson R., Deadwyler, S., Childers, S. (1996) Journal of Neuroscience 16(24), 8057-8066 • Munro, Sean, Thomas, KL, Abu-Shaar, M. (1993) Nature 365, 6-65 • Carlisle, S.J., Marciano-Cabral, F., Staab, A., Ludwick, C., and Cabral, G.A. (2001) International Immunopharmacology 2, 69-82 • Valk, P., Hol, S., Vankan, Y., Ihle, J., Askew, D., Jenkins, N., Gilbert, D., Copeland, N., De Both, N., Löwenberg, B., and Delwel, R. (1997) Journal of Virology 71, 6796-6804 • Genomatrix. MatInspector Sequence Library. Accessible from: http://www.genomatix.de/online_help/help_ matinspector/matinspector_help.html. Accessed on October 19, 2006. Testing Promoter Activity in the Cnr 2 Gene Upstream of Exon IB Allison G. Norrod and Robyn A. Puffenbarger Department of Biology, Bridgewater College, 402 East College Street, Bridgewater, VA 22812-1599, USA Introduction Cannabinoids in the body can have numerous effects from decreasing motor function, altering mental state to affecting immune function.1 Cannabinoids alter macrophages via interactions with a specific type of receptor, CB2.2 CB2 receptors are found on macrophage cells in varying amounts. The receptors are expressed in low amounts in the resident stage, high amounts during the responsive stage, and low amounts during the activated stage in the cycle of macrophage activation.3 It is suspected that expression of the CB2 receptors is regulated by promoter activity which controls transcription of DNA into mRNA. Two locations on the mouse chromosome 4 have been isolated as potential promoter sites.4 Previous research in our lab revealed that an 849 bp section upstream of exon 1B expressed promoter activity while a smaller 239 bp section lacked the same level of activity (unpublished research). Our goal is to further isolate the location of promoter activity within 849 base pairs upstream of exon 1B (Fig 1). Results/Conclusions/Future Work Luciferase assays showed the 849 bp fragment continued to express high levels of promoter activity, which agreed with previous research. The 610 bp fragment also expressed significant promoter activity in a luciferase assay (Fig 4) as was expected, given that it was the 849 bp piece minus the 239 bp fragment that lacked activity (Fig 2). Statistical data suggests that there is no difference in the level of promoter activity between the 849 and 610 bp fragments. Thus far, 2000 1650 1000 850 650 500 400 300 200 100 Legend 136 319 849 239 610 Figure 2 Upstream of Exon 1B 1B there is evidence that the 319 bp fragment expresses the same level of activity as the 849 bp fragment, but further trials are necessary to confirm its promoter activity. As shown in Fig 3, two putative binding sites are consistent with mammalian gene expression in immune cells. STAT5 and NF- κB family member binding sites are shown in a different colors (Fig 3). An electrophoretic mobility shift assay will be attempted using these two binding sites. It is hopeful that future research will be able to create nested fragments of this 610 bp fragment to further isolate the promoter to a 100-150 bp piece for further research. Also, it would be ideal to be able to test the promoter activity of all of the fragments in another macrophage cell line such as J774A1. *not to scale Methods Primers were designed to create nested fragments of the 849 bp sequence upstream of exon 1B (Fig 2) of 610, 319 and 136 bp. Fragments were amplified with Pfx proofreading Taq (Invitrogen). The fragments were cloned first into a pCR-Blunt vector and sequenced at MWG Biotech. Each fragment was cut using restriction enzymes Nhe I and HindIII in a restriction enzyme digest, and cloned into the pGL3 vector. The results were verified using colony PCR. The plasmid DNA was purified using an endotoxin-free kit from MoBio Laboratories, Inc. Cloning was not successful for the 136 bp fragment after multiple trials. A series of transfection experiments on the 610 and 319 DNA fragments were completed (as well as for the 849 bp piece from previous research) in triplicate using RAW264.7 cells (2.8 x 106 cells per 60mm dish) with 2.5 g plasmid DNA plus 10 l Lipofectamine 2000 (Invitrogen). Promoter activity data was determined via a luciferase assay. Additionally, a BioRad protein assay was completed for each sample. A GenoMatrix MatInspector search was done on the 319 bp DNA sequence to find potential transcription factor binding sites for use in an electrophoretic mobility shift assay (EMSA).5