DNA and Protein Synthesis

1. DNA and Protein Synthesis

2. Nucleic Acid Review

3. Name of the molecule identified by the arrow: • Phosphate group • Nitrogen base • Adenine • Sugar

4. Name given to the circled structure: • Nucleic acid • Amino acid • Nucleotide • Nucleus

5. The type of reaction responsible for joining molecules A and B • Hydrolysis • Dehydration A B

6. Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____: • Nucleotide • Codon • Translation • Gene • mRNA

7. Which is single stranded? • DNA • RNA

8. Which one can exit the nucleus? • DNA • RNA

9. The two strands of DNA are bonded together in the middle by their… • Sugars • Phosphates • Nitrogen bases

10. Which one contains nitrogenous bases A, T, G and C? • DNA • RNA

11. DNA is … • Single stranded • Double stranded • Triple stranded

12. Every nucleotide is made up of… • Sugar • Phosphate • Nitrogen base • All of the above

13. Nucleic Acids - Function • Control the processes of heredity by which cells and organisms reproduce proteins.

14. Nucleic Acids – Types • DNA • Deoxyribonucleic Acid • RNA • Ribonucleic Acid

15. Do you remember DNA structure? SUGAR Phosphate

16. Let’s build on that knowledge…

17. Protein Synthesis • It’s a process • DNA -> RNA -> Amino Acids (Protein)

18. RNA • Sugar is Ribose NOT what… • Has nitrogen base Uracil instead of Thymine • Also contains the other 3 bases…what are they? • Only single stranded

19. RNA

20. Three processes in this unit… • 1. Replication (DNA DNA) • 2. Transcription (DNA mRNA) • 3. Translation (RNA Protein)

21. A. DNA Replication • Occurs in the nucleus prior to any cell division • Enzyme is used to “unzip” or “unwind” the DNA • Forms a bubble at the origin site

22. DNA Replication (cont.) • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA • Nitrogenous bases pair up • A – T • C - G • As a result, you create two identical strands of DNA

23. Let’s Practice • Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

24. Let’s Build A Protein

25. Transcription • 1.) DNA strand unzips • The bonds between the nitrogen bases are broken • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA • 2.) A single strand of mRNA (messenger RNA) is made • Pair up the bases • A • T • C • G The mRNA then travels from nucleus to cytoplasm

26. Transcription

27. Where in the cell does transcription take place? • Cytoplasm • Mitochondria • Nucleus • Golgi Body • Vacuole

28. Any given segment of DNA has directions that make unique what? • Glucose • Proteins • Lipids • Blood cells

29. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence? • T G A C C A G G T T • A C T G G T C C A A • T G U C C U G G T T • U G A C C A G G U U

30. Why is mRNA called messenger RNA? • Because it carries the directions to make a protein to the ribosome like a message

31. Actually 3 types of RNA • mRNA- messenger • Brings message from nucleus to ribosomes in cytoplasm • rRNA- ribosomal • Make up a ribosome • tRNA- transfer • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

32. The difference between RNA and DNA is what? • The phosphates • The sugars • The nitrogen bases • The way the monomer units bond

33. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? • Mitochondria • Ribosome • Golgi Body • Lysosome • Nucleus

34. Translation 1. mRNA meets up with a ribosome…why?? • Ribosomes are the site for protein production 2. tRNAmolecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNAanticodon • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid • Anticodon: 3 Nitrogen base sequence in tRNA

35. Translation (cont.) • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

36. That’s the process, Now how do you know what amino acids make up a particular protein • We use an mRNA codon chart

37. Where in the cell does transcription, the first part of protein synthesis, take place? • Mitochondria • Nucleus • Ribosomes • Cytoplasm

38. DNA has the directions to make what? • Glucose • Nucleotides • Proteins • Monosaccharides

39. After a strand of mRNA is made where does it go? • Ribosome • Mitochondria • Lysosome • Vacuole

40. Where in the cell does translation, the second part of protein synthesis, take place? • Mitochondria • Nucleus • Golgi body • Cytoplasm

41. Molecules called tRNA’s are floating around the cytoplasm carrying what? • mRNA’s • Glucose • DNA • Nucleotides • Amino Acids

42. An mRNA codon is made up of how many nitrogen bases? • 1 • 3 • 6 • 24

43. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? • Phenylalanine • Glutamine • Asparagine • Lysine • Tyrosine

44. What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C • Threonine – phenylalanine – glutamate – tyrosine • Phenylalanine – leucine – methionine – valine • Tyrosine – glutamate – phenylalanine – threonine • Lysine – cysteine – arginine – histidine

45. What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G • Isoleucine – alanine – histidine – alanine • Isoleucine – histidine – alanine – isoleucine • Phenylalanine – leucine – valine – arginine • Isoleucine – leucine – threonine – lysine

46. How would you assess your comprehension of DNA and Protein Synthesis? • A • B • C • D