which crosses

1. Hybridization Inbreeding Dissimilar organisms Similar organisms Organism breed B Organism breed A Organism breed A Retains desired characteristics Combines desired characteristics Concept Map Section 13-1 Selective Breeding consists of which crosses which crosses for example for example which which

2. Interest Grabber Section 13-2 The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

3. Interest Grabber continued Section 13-2 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

4. Section Outline Section 13-2 • 13–2 Manipulating DNA • A. The Tools of Molecular Biology • 1. DNA Extraction • 2. Cutting DNA • 3. Separating DNA • B. Using the DNA Sequence • 1. Reading the Sequence • 2. Cutting and Pasting • 3. Making Copies

5. Restriction Enzymes Section 13-2 Recognition sequences DNA sequence

6. Restriction Enzymes Section 13-2 Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end

7. Figure 13-6 Gel Electrophoresis Section 13-2 Power source DNA plus restriction enzyme Longer fragments Shorter fragments Gel Mixture of DNA fragments

8. Figure 13-7 DNA Sequencing Section 13-2

9. Figure 13-8 PCR Section 13-2 DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCRcycles 1 DNAcopies 1 3 4 4 8 5 etc. 16 etc. 2 2

10. Interest Grabber Section 13-3 Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

11. Interest Grabber continued Section 13-3 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

12. Section Outline Section 13-3 • 13–3 Cell Transformation • A. Transforming Bacteria • B. Transforming Plant Cells • C. Transforming Animal Cells

13. Knockout Genes Section 13-3 Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA

14. Figure 13-9 Making Recombinant DNA Section 13-3 Gene for human growth hormone Recombinant DNA Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid

15. Figure 13-10 Plant Cell Transformation Section 13-3 Agrobacterium tumefaciens Gene to be transferred Cellular DNA Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Recombinant plasmid Plant cell colonies Transformed bacteria introduce plasmids into plant cells Complete plant is generated from transformed cell

16. Interest Grabber Section 13-4 The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

17. Interest Grabber continued Section 13-4 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

18. Section Outline Section 13-4 • 13–4 Applications of Genetic Engineering • A. Transgenic Organisms • 1. Transgenic Microorganisms • 2. Transgenic Animals • 3. Transgenic Plants • B. Cloning

19. Flowchart Section 13-4 Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.

20. Figure 13-13 Cloning of the First Mammal Section 13-4 A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell Egg Cell The nucleus of the egg cell is removed. An egg cell is taken from an adult female sheep. The fused cell begins dividing normally. Embryo Cloned Lamb The embryo is placed in the uterus of a foster mother. The embryo develops normally into a lamb—Dolly Foster Mother

21. Video Video Gene Transfer • Click the image to play the video segment.

22. End of Custom Shows • This slide is intentionally blank.