Genome Sizes are Large human 3 x 109 bp E. coli 4 x 106 bp

Aug 30, 2012

180 likes | 330 Views

Nucleases. exonucleasesremove single nucleotides from 3'- or 5'-end depending on specificitymost exhibit specificity for either RNA, ssDNA or dsDNAgood for removing undesired nucleic acid or removing single stranded overhangs from dsDNAendonucleasescleaves phoshodiester bonds within fragmentsl

Share Presentation

Embed Code

Link

jennis

Download Presentation

Genome Sizes are Large human 3 x 109 bp E. coli 4 x 106 bp

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

BP Azerbaijan

BP Azerbaijan. 2010 Graduate and Intern Recruitment Program. Career in BP. When the people we hire today shape the business we are tomorrow. Challenge program.

685 views • 8 slides

Maximize: 5 x 1 + 4 x 2 + 3 x 3 subject to: x 1 , x 2 , x 3 ≥ 0 and

Maximize: 5 x 1 + 4 x 2 + 3 x 3 subject to: x 1 , x 2 , x 3 ≥ 0 and 2 x 1 + 3 x 2 + 1 x 3 ≤ 5 4 x 1 + 1 x 2 + 2 x 3 ≤ 11 3 x 1 + 4 x 2 + 2 x 3 ≤ 8 After one pivot: H N T = [4 2 3] X1 = 2.5 -1.5 X2 -0.5 X3 -0.5 X4

308 views • 19 slides

f(x) = x 3 + 2x +3 g(x) = 2 x + x 2 + x + 4 h(x) = x 2 + 3x 3 + 2x + 1 t(x) = x -2 + x + 2

Do Now: Do we have a polynomial function? Is it in standard form? What is the degree? What is the leading coeficient ?. f(x) = x 3 + 2x +3 g(x) = 2 x + x 2 + x + 4 h(x) = x 2 + 3x 3 + 2x + 1 t(x) = x -2 + x + 2. Chapter 2.2/ 2. SWBAT Evaluate and Graph Polynomial Functions

312 views • 17 slides

50 bp

100%. 100%. 0%. 0%. 0%. 0%. 40. 10. 20. 30. 100%. 100%. 50 bp. A. Transposase based dendrogram. B. IS DNA extremities. C. DR lengths. Subgroups. CATGCCCATCAA+TTAAGAATTTAGACTACCCCCAAAAATAAAAAAACGT CATGCCCATCAACTTAAGGAAAAAAATAAAAAGAAATTA+GTTTATT+TG. IRL IRR. IS 231.

143 views • 1 slides

BP Educational Resources bp

BP Educational Resources www.bp.com. BP Website - Site Map. About BP. More About Us; United States. BP & Education. Where We Operate. Educational Resources. Fabric of America. BP Worldwide. A+ for Energy. Education. North America; U.S. BP Education Landing Page.

445 views • 23 slides

E. coli Genome

For Bioinformatics. , Start with Genomics:. The Human Genome. ANIMALS Typically, - 10 8 - >10 9 bp - Sequence with many gaps - 95+% covered. After Sequencing and Assembly. PROKARYOTES Typically, - >10 6 bp - Sequence without gaps. E. coli Genome.

891 views • 55 slides

BP = CO x TPR

BP = CO x TPR. (stroke volume x heart rate). BP = blood pressure CO = cardiac output TPR = Total peripheral resistance. 5. Plateau. Ascending limb. 70. Normal, rest. 5. 10. 15. ‘The energy of contraction - - - is proportional to the muscle fibre length at rest.

2.55k views • 131 slides

-198 bp - -175 bp - - 23 bp -

Cell line DNA conc. A260/A280 HGF-1 [884 ng/ m L] 1.90 SCC25 [895 ng/ m L] 1.87 SCC15 [850 ng/ m L] 1.76 CAL27 [821 ng/ m L] 1.92. MTHFR C677T Genotype. B. -198 bp - -175 bp - - 23 bp -. HGF-1 SCC25 SCC15 CAL27. 1: HGF-1 2: SCC25

114 views • 1 slides

Genome Sizes are Large human = 3 x 10 9 bp E. coli = 4 x 10 6 bp

Modifying DNA. study of individual genes requires manipulation of nucleic acids enzymes are used to modify nucleic acids, eg.: nucleases : break down nucleic acids into smaller fragments or nucleotides polymerases : synthesize DNA (ie, copy templates)

645 views • 18 slides

historical costs to sequence the 3 billion bp of a human genome

Gordon Moore. $3 billion. $300 million. two vendors. $300,000. competition. historical costs to sequence the 3 billion bp of a human genome. BGI Offers Next-Gen Sequencing Service: Kicks Off 100-Genome Sequencing Project [8 January 2008]

240 views • 12 slides

4 X 3=

4 X 3=. 12. 6 X 8=. 48. 7 X 7=. 49. 0 X 4=. 0. 9 X 6=. 54. 5 X 3=. 15. 5 X 5=. 25. 2 X 6=. 12. 3 X 8=. 24. 2 X 5=. 10. 7 X 6=. 42. 7 X 8=. 56. 3 X 2=. 6. 2 X 7=. 14. 3 X 3=. 9. 6 X 8=. 48. 6 X 5=. 30. 7 X 4=. 28. 3 X 9=. 27. 5 X 9=. 45. 8 X 2=. 16. 7 X 3=.

583 views • 53 slides

=x 2 +5 x +6 =x 2 -3 x -4 =x 2 -11 x + 30

活动与探索： ① ( x +2)( x +3) ②( x -4)( x +1) ③ ( x -5)( x -6) ( x + p )( x + q ). =x 2 +5 x +6 =x 2 -3 x -4 =x 2 -11 x + 30. =x 2 +( p + q ) x + pq. 利用你发现的规律口答： ① ( y +4 )( y -2 ) ②( y -5 )( y -3 ) ③( a -2 )( a +5 ) ④( a +9 )( a -9 ). 口答 : (1)(P+1) 2 ＝ (P+1)(P+1 )= . (2)(m+2) 2 = .

239 views • 13 slides

Distribute: 3(x + 4) = 3(x – 4) = -3(x – 4) = -3(x + 4) =

Which of the following are equivalent? A) -3 + (-6) B) -3 – 6 C) 3 + 6 D) -3 – (-6) E) 3 – 6 F) -6 - 3. Which of the following are equivalent? A) -3 + (-6) = -9 B) -3 – 6 = -9 C) 3 + 6 = 9 D) -3 – (-6) = -3 +6 = 3 E) 3 – 6 = -3 F) -6 – 3 = -6 + -3 = -9.

729 views • 65 slides

9 3 X 9 X (D) 9 X 2 (E) 3 X 2

A circle has a radius of R and an area of X. In terms of X , what is the area of a circle with radius 3 R?. 9 3 X 9 X (D) 9 X 2 (E) 3 X 2.

435 views • 36 slides

4 x 3 =

4 x 3 =. 12. 8 x 3 =. 24. 2 x 3 =. 6. 6 x 3 =. 18. 1 x 3 =. 3. 5 x 3 =. 15. 9 x 3 =. 27. 7 x 3 =. 21. 10 x 3 =. 30. 3 x 3 =. 9.

256 views • 20 slides

1 x 3 = 3 2 x 3 = 6 3 x 3 = 9 4 x 3 = 12 5 x 3 = 15 6 x 3 = 18

x3. 1 x 3 = 3 2 x 3 = 6 3 x 3 = 9 4 x 3 = 12 5 x 3 = 15 6 x 3 = 18 7 x 3 = 21 8 x 3 = 24 9 x 3 = 27 10 x 3 = 30. Spencer.

91 views • 1 slides

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp

2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp. 2000 bp 1000 bp 750 bp 500 bp 250 bp 100 bp. 994 bp 665 bp 448 bp 243 bp 143 bp.

141 views • 1 slides

More Related