1 / 26

Chromosome Structure, Replication, & Mobile DNA

This text covers the topics of chromosome structure, replication, and mobile DNA units, including chromatin structure, DNA replication, telomeres, DNA repair, mutations, and repetitive DNA.

jharriss
Download Presentation

Chromosome Structure, Replication, & Mobile DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chromosome Structure, Replication & Mobile DNA From chapters 5 & 6 & 9 Chapter 5 While we will not cover DNA structure in class formally, but you should review materials in the chapter on the fundamental structures of DNA. We will discuss in class chromatin structure covered on pages pp 184-192. In Chapter 6, you will not be responsible for the details of homologous recombination. In Chapter 9, the sections about transposable elements (mobile DNA units) DNA Helicase Questions in this chapter you should be able to answer: Chapter 5- #s 1, 3, 4, 5A & B, 7, 11-14, 16 Chapter 6- #s 1 - 8, 12 -16 Chapter 9- #s 1, 6,7,9,10 Chromatin Structure and Replication

  2. From Chapter 5 Eukaryotic DNA exists as chromatin Chromatin = DNA + histones Nucleosome core Histone octet H1 Nucleosome Chromatin Structure and Replication

  3. Nucleosomes allow for DNA condensation and “remodeling” Histone modifications Hetero- & Euchromatin DNA supercoiling “Inheritable” Supercoiling Chromatin Structure and Replication

  4. From Chapter 6 Why is DNA replication said to be ‘semiconservatve’? Read How We know about Meselson and Stahl experiment Chromatin Structure and Replication

  5. In what direction does DNA replication occur? Where does energy for addition of nucleotide come from? What happens if a base mismatch occurs? DNA Orietation Chromatin Structure and Replication

  6. Why does DNA replication only occur in the 5’ to 3’ direction? (Picture not in 4th edition) Chromatin Structure and Replication

  7. Where does DNA replication begin on a chromosome? Answer Question 6-1A How long until forks 4 and 5 meet? Distance between bases is 0.34 nm Replication rate is 100 bases / sec • How many nM / mM? 2) How many nM between 4 - 5? 3) How many bases between 4 – 5? 4) How long to replicate this region? Chromatin Structure and Replication

  8. How is DNA synthesized on 3’ end ‘behind’ advancing replication fork? Okasaki fragments Chromatin Structure and Replication

  9. Why does DNA synthesis begin with an RNA primer? How are Okasaki fragments synthesized and connected? Chromatin Structure and Replication

  10. How do other proteins contribute to DNA replication? Helicase Topoisomerase ssDNA binding proteins Sliding clamp DNA Polymerases Ligase Replication Fork DNA Replication Chromatin Structure and Replication

  11. Telomeres pose a special DNA replication problem ~ 7-10,000 bases Telomere repeat sequence TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG  AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC  -- 1000s X = “Sacrificial DNA” Chromatin Structure and Replication 11

  12. What is the telomere replication problem? Terminal 3’ end cannot be replicated by DNA polymerase Chromatin Structure and Replication

  13. How does telomerase solve the problem?? RNA template Telomerase and cancer treatment Telomere Replication Chromatin Structure and Replication

  14. Telomere shortening protects us against cancer Cancer cells become immortal by activating telomerase Stem cells are thus prone to cancer Chromatin Structure and Replication 14

  15. Is telomere lengthening the answer to eternal youth? ABC News report Chromatin Structure and Replication

  16. Some viruses cause cell proliferation and cancer ~12-18% of human cancers Viruses prefer dividing cells Human papilloma viruses (HPV) Epstein-Barr Hepatitis B & C Kaposi’s sarcoma herpesvirus HPV 16 & 18 Pack 3 Powerful Proteins E5 – suppresses MHC production -- promotes immune evasion E6 – inactivates p53 TSG -- genome instability – activates telomerase -- confers immortality E7 – triggers cell proliferation – promotes angiogenesis Chromatin Structure and Replication

  17. How is damaged DNA repaired? Surveillance & repair proteins 1) Mismatch repair during S-phase -- how does the cell know which base to replace? 2) Excision repair (mismatch) -- post S-phase -- 3 steps -- 50% chance of error Chromatin Structure and Replication

  18. How is damaged DNA repaired? 3) End-joining of DS breaks -- Nonhomologous end joining -- short deletion 4) Homologous recombination -- usually S-phase -- sequence on homolog is used Chromatin Structure and Replication

  19. Mutations accumulate over time Numerous single-nucleotide polymorphisms (SNP) distinguish individual genomes Consequence of “point mutations” 107+ documented in humans Can influence: Our individual physical traits Disease susceptibility Risk factors for disorders e.g., Macular Degeneration SNP in Complement factor H His  Tyr 5 – 7x >risk Chromatin Structure and Replication

  20. ~50% of the human genome is repetitive DNA Two main types: “Tandem repetitive DNA”: 1 - 100+ base sequences “CAG CAGCAGCAGCAG… “GGAAT GGAATGGAAT… “Interspersed Nuclear Elements”: 100s – 104 base sequences -- most are “transposable elements” -- make copies of themselves . . . repeated 10s  106s of times Chromatin Structure and Replication

  21. Tandem Repetitive DNA is linked to several genetic diseases -- “Trinucleotide repeat expansion” disorders Huntington’s disease -- neurodegenerative -- late onset -- inheritance is Dominant -- Repeat #  onset age & severity Chromatin Structure and Replication

  22. Transposable Elements have accumulated over time Examples LINE (Long) elements, e.g., ‘L1’ -- 1000s Bp long ~ 500,000 copies = ~20% of genome -- encode genes for own movement SINE (short) elements, e.g, ‘Alu’ – 300 Bp long -- 106 copies = ~ 13% of genome Chromatin Structure and Replication

  23. Transposable Elements are fascinating -- and disconcerting! DNA that moves around “Jumping genes” Some move via “Cut and Paste” (no longer active in humans) Some move via “Copy and Paste” -- still active!! Chromatin Structure and Replication

  24. Inverted sequences How do transposable elements move? 1) DNA-only mechanism -- common in bacteria, plants, yeast, insects Mechanism of cut and paste transposition 2) Alu and Li are retrotransposons -- Pass through RNA form -- Use reverse transcriptase Chromatin Structure and Replication

  25. TE movements have been linked to human diseases -- estimated to cause 0.3% of human genetic disorders Belancio et al (2008) Genome Res. 18: 343-358 Genetic analysis of mutated genes in individuals BRCA1 gene:42% of gene is Alu sequences in introns Chromatin Structure and Replication

  26. The Good News: TEs are not running rampant Most are inactive – mutated ‘fossils’ – host suppressive mechanisms ~ 80-100 active L1s Beneficial roles -- not fully understood Roles in regulating gene expression -- the space between genes matters -- changes alter patterns of gene expression -- TE RNAs appear to have functions Have given rise to new genes --e.g., telomerase; RAG enzymes -- Intron/Exon diversity Roles in neurological development? Chromatin Structure and Replication

More Related