1 / 1

42 PemK- like

sFig.1. GA-ILR. T- leu G- arg. 9231. GBS-NY Sa ( vanG- 1). 1. 2. a. 6. 7. 8. 9. 10. 3 parA plasmid partitioning. 4 parB. 5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif. 8537. RI-XB6B4. 1. 2. 3. 4. a. 5. 6. 7. 8. 10.

joshua-cruz
Download Presentation

42 PemK- like

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. sFig.1 GA-ILR T-leu G-arg 9231 GBS-NY Sa (vanG-1) 1 2 a 6 7 8 9 10 3 parA plasmid partitioning 4 parB 5 rrgA-like pilus-associated adhesin C-terminal peptidoglycan-binding motif 8537 RI-XB6B4 1 2 3 4 a 5 6 7 8 10 transcriptional represssor, plasmid mobilization 9,265 25,689 GBS-NY Sa (vanG-1) 18 11 DNA/RNA helicase; methylase 12 b 14 15 16 21 VirD4 family conjugation 19 20 13 topoisomerase /primase 17 relaxase/ plasmid mobilization nuclease domain 8561 25,698 RI-XB6B4 11 12 H 13 14 15 16 17 18 19 20 21 33,178 25,704 GBS-NY Sa (vanG-1) 24 type IV secretion 22 23 26 25 type IV secretion 27 type IV secretion, RecA-like ATPase c 28 peptidoglycan hydrolase 33,209 25,701 RI-XB6B4 22 23 24 25 26 27 28 c % sequence identity P(constitutive) P(inducible) -35 -10 IRR-GA AAAAAACAGCACTCTTGTTTTTGATACAAT TTGctt-N17-TAaAAT >95-100 U R S Y W G XY T C T GBS-NY Sa (vanG-1) 45,585 >90- 95 40 29 30 31 32 33 34 35 36 37 38 39 41 43 42 PemK- like 44 serine recombinase/ integrase 33,354 39,170 >80-90 -35 -10 IRR-GA >70-80 TTGagg-N17-TATAAT Y >57-70 41,597 * * RI-XB6B4 I J K L M 32 N O 40’ 41’ 42 43 44 <30% 33,346

More Related