1 / 36

DNA

DNA. What does DNA mean? Deoxyribonucleic Acid Where does DNA come from? 1/2 from mom 1/2 from dad “Blue print” of life Comparing Areas of DNA Common Different Very different. Cell. Where can DNA be found?. Cell Types. Blood. Hair Roots. Saliva. SAME. Sweat. Semen.

kasimir-hodge
Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA • What does DNA mean? • Deoxyribonucleic Acid • Where does DNA come from? • 1/2 from mom • 1/2 from dad • “Blue print” of life • Comparing Areas of DNA • Common • Different • Very different

  2. Cell Where can DNA be found? Cell Types Blood Hair Roots Saliva SAME Sweat Semen Various Tissue

  3. Types of objects where DNA may be found • Chewing Gum • Stamps & Envelopes • Penile Swabs • Washed Stains • Door Knobs • Tooth Brushes • Sanitary Pads • Tooth Pulp • Sweaty Clothing • Telephones • Bone Marrow • Hair Brushes • Tobacco Pipes • Cigarette Butts

  4. Cell Nucleus Where does DNA come from?

  5. Nucleus Paternal Chromosome Maternal Chromosome Where does DNA come from?

  6. Chromosome DNA Where does DNA come from?

  7. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Chromosomes

  8. Double Helix A T C G DNA- What it looks like Units A =Adenine T =Thymine G =Guanine C =Cytosine

  9. A A G T G A T T C A C T T DNA- What it looks like Sense Anti-sense Sequence = The order of the bases along a strand

  10. AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCCAGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC DNA- What it looks like 1 Million Lines = 1 Chromosome

  11. DNA- What it looks like Coding Regions Non-coding Regions

  12. DNA – Coding Regions • Areas that determine physical traits • - Our “Genes” • Almost Identical for all People • - > 99% Homology • Less than half of all DNA

  13. DNA – Non-coding Regions • More than half of all DNA • Called “Junk DNA” • Long stretches of repeating sequences • - Sequence length varies • Several Regions “Hypervariable” • -as many as 30 different variants

  14. “Hypervariable” Regions • Number of sequence repeats varies • - 2 repeats to > 100 repeats • Number of base pairs varies • Several regions very well characterized • - Reliable, discrete analysis of loci • - Documented population statistics

  15. “Hypervariable” Regions • Longer sequences • - Analyzed using restriction enzymes and • radioactive probes (RFLP) • Short sequences • - 3, 4, 5 bases long • - Analyzed using Polymerase Chain • Reaction (PCR) amplification • - Analyzed using Capillary Electrophoresis (CE) • and fluorescence labeling • - Short Tandem Repeats (STR)

  16. (Core sequence AGAT) 7 Bases Bases Bases Bases Bases Bases Bases 5 Bases Bases Bases Bases Bases STR Short Tandem Repeats AGAT AGAT AGAT AGAT

  17. Isolation of DNA Chemical DNA - Blood - Hair Roots - Saliva - Sweat - Semen - Various Tissue

  18. DNA Amplification (making copies) Solution • Primers • Nucleotides • Taq Polymerase

  19. A A T T G C G C A A T T T A T A A T A T G G C C Heat Denature Step one of a single cycle

  20. Primer A A G T G A T T C A C A A T T T T T C DNA Template Anneal Step two of a single cycle

  21. T G G A Nucleotides C A T T Primer G A G T A A G T G A A T G A T A T A T T C T A T C C T DNA Template Extend Step three of a single cycle

  22. Amplification 28 Cycles 1 Cycle 2 Cycles DNA 3 Cycles 4 Cycles 5 Cycles PCR (Polymerase Chain Reaction)

  23. Amplified DNA Analysis of amplified DNA DNA Profile

  24. 9 Loci • 3 Colors ABI310 DNA Profile • Internal • Standard • 1 Color

  25. Allelic Ladder Sample Profile Allele Sizing Fragment Size Analysis

  26. Allelic Ladder Sample Profile Allele Sizing Based on Number of Repeats

  27. Statistical Analysis Locations well characterized - Numerous, well-accepted data tables - All tables have similar allele percentages for the various population groups Locations independently inherited - One locus does not influence another - Product Rule applies

  28. 0.0667 X 0.0667 X 0.0667 X 0.0667 X 0.0667 The Product Rule BINGO Analogy B 1 - 15 I 16 - 30 N 31 - 45 G 46 - 60 O 61 - 75 1 out of 15 1 out of 15 1 out of 15 1 out of 15 1 out of 15 = 0.0000013 = 1 out of 750,000

  29. The Product Rule If we were playing “BAKERSFIELD” 11 letters at 1 out of 15 per letter: 1 out of 39 trillion

  30. DNA Analysis Scheme • BPD Item 01-#3b (Swab of Bloodstain) • Known Samples • Controls • Isolated • Amplified • Analyzed

  31. D3S1358 vWA FGA Bloodstain Shell Clevenger St. Clair

  32. D5S818 D13S317 D7S820 Bloodstain Shell Clevenger St. Clair

  33. D8S1179 D21S11 D18S51 Amel Bloodstain Shell Clevenger St. Clair

  34. Chromosome Nucleus Cell Nucleus DNA Paternal Chromosome Maternal Chromosome Where does DNA come from?

More Related