360 likes | 498 Views
DNA. What does DNA mean? Deoxyribonucleic Acid Where does DNA come from? 1/2 from mom 1/2 from dad “Blue print” of life Comparing Areas of DNA Common Different Very different. Cell. Where can DNA be found?. Cell Types. Blood. Hair Roots. Saliva. SAME. Sweat. Semen.
E N D
DNA • What does DNA mean? • Deoxyribonucleic Acid • Where does DNA come from? • 1/2 from mom • 1/2 from dad • “Blue print” of life • Comparing Areas of DNA • Common • Different • Very different
Cell Where can DNA be found? Cell Types Blood Hair Roots Saliva SAME Sweat Semen Various Tissue
Types of objects where DNA may be found • Chewing Gum • Stamps & Envelopes • Penile Swabs • Washed Stains • Door Knobs • Tooth Brushes • Sanitary Pads • Tooth Pulp • Sweaty Clothing • Telephones • Bone Marrow • Hair Brushes • Tobacco Pipes • Cigarette Butts
Cell Nucleus Where does DNA come from?
Nucleus Paternal Chromosome Maternal Chromosome Where does DNA come from?
Chromosome DNA Where does DNA come from?
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y Chromosomes
Double Helix A T C G DNA- What it looks like Units A =Adenine T =Thymine G =Guanine C =Cytosine
A A G T G A T T C A C T T DNA- What it looks like Sense Anti-sense Sequence = The order of the bases along a strand
AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCCAGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC AGCTCGATCGATCGCTCGATCGCTAGCTCGCTCTGAGCTAGCTAGCTCGCTAGCTAGCTCGCTCGATCGCCC DNA- What it looks like 1 Million Lines = 1 Chromosome
DNA- What it looks like Coding Regions Non-coding Regions
DNA – Coding Regions • Areas that determine physical traits • - Our “Genes” • Almost Identical for all People • - > 99% Homology • Less than half of all DNA
DNA – Non-coding Regions • More than half of all DNA • Called “Junk DNA” • Long stretches of repeating sequences • - Sequence length varies • Several Regions “Hypervariable” • -as many as 30 different variants
“Hypervariable” Regions • Number of sequence repeats varies • - 2 repeats to > 100 repeats • Number of base pairs varies • Several regions very well characterized • - Reliable, discrete analysis of loci • - Documented population statistics
“Hypervariable” Regions • Longer sequences • - Analyzed using restriction enzymes and • radioactive probes (RFLP) • Short sequences • - 3, 4, 5 bases long • - Analyzed using Polymerase Chain • Reaction (PCR) amplification • - Analyzed using Capillary Electrophoresis (CE) • and fluorescence labeling • - Short Tandem Repeats (STR)
(Core sequence AGAT) 7 Bases Bases Bases Bases Bases Bases Bases 5 Bases Bases Bases Bases Bases STR Short Tandem Repeats AGAT AGAT AGAT AGAT
Isolation of DNA Chemical DNA - Blood - Hair Roots - Saliva - Sweat - Semen - Various Tissue
DNA Amplification (making copies) Solution • Primers • Nucleotides • Taq Polymerase
A A T T G C G C A A T T T A T A A T A T G G C C Heat Denature Step one of a single cycle
Primer A A G T G A T T C A C A A T T T T T C DNA Template Anneal Step two of a single cycle
T G G A Nucleotides C A T T Primer G A G T A A G T G A A T G A T A T A T T C T A T C C T DNA Template Extend Step three of a single cycle
Amplification 28 Cycles 1 Cycle 2 Cycles DNA 3 Cycles 4 Cycles 5 Cycles PCR (Polymerase Chain Reaction)
Amplified DNA Analysis of amplified DNA DNA Profile
9 Loci • 3 Colors ABI310 DNA Profile • Internal • Standard • 1 Color
Allelic Ladder Sample Profile Allele Sizing Fragment Size Analysis
Allelic Ladder Sample Profile Allele Sizing Based on Number of Repeats
Statistical Analysis Locations well characterized - Numerous, well-accepted data tables - All tables have similar allele percentages for the various population groups Locations independently inherited - One locus does not influence another - Product Rule applies
0.0667 X 0.0667 X 0.0667 X 0.0667 X 0.0667 The Product Rule BINGO Analogy B 1 - 15 I 16 - 30 N 31 - 45 G 46 - 60 O 61 - 75 1 out of 15 1 out of 15 1 out of 15 1 out of 15 1 out of 15 = 0.0000013 = 1 out of 750,000
The Product Rule If we were playing “BAKERSFIELD” 11 letters at 1 out of 15 per letter: 1 out of 39 trillion
DNA Analysis Scheme • BPD Item 01-#3b (Swab of Bloodstain) • Known Samples • Controls • Isolated • Amplified • Analyzed
D3S1358 vWA FGA Bloodstain Shell Clevenger St. Clair
D5S818 D13S317 D7S820 Bloodstain Shell Clevenger St. Clair
D8S1179 D21S11 D18S51 Amel Bloodstain Shell Clevenger St. Clair
Chromosome Nucleus Cell Nucleus DNA Paternal Chromosome Maternal Chromosome Where does DNA come from?