Recombinant DNA & Biotechnology

1. Recombinant DNA & Biotechnology

2. Recombinant DNA • recombinant DNA molecules contain DNA from different organisms • any two DNAs are joined by DNA ligase 5’GGATCATGTA-OHP-CCCGATTTCAAT 3’CCTAGTACAT-PHO-GGGCTAAAGTTA 5’GGATCATGTACCCGATTTCAAT 3’CCTAGTACATGGGCTAAAGTTA DNA ligase

3. restriction enzymes degrade invading viral DNAFigure 16.1 figure 17-01.jpg

4. Cleaving and Rejoining DNA • RE produce many different DNA fragments

5. restriction enzymes recognize specific DNA sequences (recognition sites) EcoRI 5’GGATCGAATTCCCGATTTCAAT 3’CCTAGCTTAAGGGCTAAAGTTA a palindrome reads the same left-to-right in the top strand and right-to-left in the bottom strand

6. staggered cuts produce “sticky ends”Figure 16.4

7. Cutting and Rejoining DNA • restriction enzymes (RE) produce specific DNA fragments for ligation • RE are defensive weapons against viruses • RE “cut” (hydrolyze) DNA at specific sites • RE “staggered cuts” produce “sticky ends” • sticky ends make ligation more efficient

8. gel electrophoresisFigure 16.2

9. Cleaving and Rejoining DNA • RE produce many different DNA fragments • for a 6 bp recognition site 1/46 = 1/4096 x 3x109 bp/genome = 7.3 x105 different DNA fragments • gel electrophoresis sorts DNA fragments by size • hybridization with a labeled probe locates specific DNA fragments

10. Southern hybridization of a labeledprobe to a DNA targetFigure 16.3

11. gel electrophoresis & Southern hybridization

12. Cloning Genes • genetic engineering requires lots of DNA • cloning produces lots of exact copies • DNA clones are replicated by host cells • DNA is cloned in a DNA vector • a DNA vector has an origin of replication (ori) that the host cell recognizes

13. pBR322 is a historical bacterial cloning plasmida Yeast Artificial Chromosome vector has yeast ori, centromere and telomeresAgrobacterium Ti plasmid has an Agrobacterium ori and T DNA that integrates into plant DNAFigure 16.5

14. Cloning Genes • a DNA vector with its ligated insert must be introduced into the host cell • chemical treatment makes cells “competent” - ready for heat shock transformation • electroporation opens pores in the plasma membrane • mechanical treatment inserts DNA physically

15. Cloning Genes • vectors carry reporter genes • antibiotic resistance protects host cells that carry a vector (selection) • proteinssuch as -galactosidase, luciferase or Green Fluorescent Protein (GFP) identify transformed cells (screening)

16. bacterial plasmid pBR322 is a cloning vector that encodes ampicillin & tetracycline antibiotic resistancesinsertion of a target DNA inactivates tetracycline resistanceFigure 16.6

17. ligating vector to insert ~4300 bp; 0.1 µg; 1.7 x 1011 molecules each cut with the same RE + 900 bp; 0.063 µg; 5.7 x 1010 molecules DNA ligase

18. ligation/transformation • ligation of vector to insert produces several products • vector ligated to itself (recircularized) • insert ligated to itself (circularized, no ori) • two vectors ligated together • two (or more) inserts ligated together • several DNAs ligated together, but not circularized • 1 vector ligated to 1 insert DNA

19. ligation/transformation • transformation is a very inefficient process 1µg typical plasmid vector = 3 x 1011 copies added to highly competent E. coli cells yields at best 109 antibiotic resistant colonies 3 x 1011/109 = 300 vectors/transformed E. coli

20. ligation/transformation • ligation produces a mess of products • transformation is an inefficient random process • selection (antibiotic) sorts out successful vector transformations • screening identifies transformants with the insert in the vector

21. 8.5 x 107 cells are plated 37 form colonies 24 contain vectors with inserts

22. bacterial transformation has several potential outcomesFigure 16.6

23. creation of a DNA library in host bacteria using a plasmid vectorFigure 16.7

24. Sources of DNA for Cloning • chromosomal DNA restriction fragments • ligated to vectors cut with the same RE • transferred into bacteria = a genomic DNA library • a target DNA is identified by hybridization

25. reverse transcription produces DNA from an RNA templateFigure 16.8

26. Sources of Genes for Cloning • mRNAs reverse transcribed into cDNAs • tissue-specific; age specific; treatment vs. normal, etc. cDNAs • ligated to vectors • grown in host cells and screened by hybridization

27. Sources of Genes for Cloning • make DNA sequences synthetically • custom oligonucleotides duplicate natural sequences or create mutant sequences • site-directed mutagenesis makes an exact change (mutation) in a cloned gene

28. What to do With a Cloned (Altered?) Gene • compare gene expression in two cell types • a “gene chip” (microarray) displays short synthetic oligonucleotides • mRNAs from two different sources are labeled differently • mRNAs bind to their complements • a scanner detects mRNA binding by one cell type, the other, or both

29. microarray analysis compares gene expression in two different samplesFigure 16.10

30. What to do With a Cloned (Altered?) Gene • mutational analysis • classical genetics found mutations and studied their effects • cloning technology causes mutations and studies their effects • “knockout” mutations

31. insertion of an inactivated gene by homologous recombinationFigure 16.9

32. What to do With a Cloned (Altered?) Gene • RNA interference (RNAi) produces a “knockdown” phenotype • a gene transcribed “backwards” makes an antisense transcript • antisense transcript + normal mRNA = double-stranded RNA • small interfering RNA (siRNA) forms double-stranded RNA with normal mRNA • some viruses inject double-stranded RNA

33. What to do With a Cloned (Altered?) Gene • eukaryotic cells attack d.s. RNA • enzymes “cut” d.s. RNA into 21-23 nt siRNAs (“dicer”) • siRNAs guide enzymes to cut target RNAs (“slicer”) • siRNAs guide RNA dependent RNA polymerase to make more d.s. RNA • [miRNAs control developmental gene expression]

34. siRNA is used to silence gene expressionFigure 16.11

35. What to do With a Cloned (Altered?) Gene • search for “invisible” interactions • two hybrid systems identify a receptor’s ligand • split a transcription activator into DNA-binding and activating domains • fuse receptor to DNA-binding domain • fuse cDNA library to activating domain • activate a reporter gene when receptor and ligand bind

36. a two-hybrid system detects binding proteinsFigure 16.12

37. What to do With a Cloned (Altered?) Gene • make the protein… • a cloning vector tells the cell to replicate it (with an ori) • an expression vector tells a cell to efficiently transcribe and translate a gene in it

38. an expression vector instructs a host cell to make a proteinFigure 16.13

39. tissue plasminogen activator is a clot busterFigure 16.14

40. Table 16.1

41. What to do With a Cloned (Altered?) Gene • medically useful proteins have been expressed • plant biotechnology speeds up crop improvement • endogenous insecticides • herbicide resistance • improved nutrition • stress tolerance • “biotech” animals serve as bioreactors to produce useful proteins

42. “somatic cell nuclear transfer”with engineered cells makes a sheep that produces a useful protein

43. CSI • Short Tandem Repeats (STRs) are used to identify individuals by “DNA Fingerprinting” • many sets of STRs exist in the human genome • the lengths of STR markers differs for different individuals • different-sized STR markers run differently on agarose gels

44. DNA fingerprint analysis using an STR markerFigure 16.17

45. Figure 16.18