170 likes | 568 Views
Isolation and Characterization of the Metallothionein Promoter in Artemia. Background. metallothionein = MT metal-binding protein four isoforms identified in mammals: MT-I, MT-II, MT-III and MT-IV diverse functions -metal ion homeostasis
E N D
Isolation and Characterization of the Metallothionein Promoter in Artemia Gwen Jordaan
Background metallothionein = MT metal-binding protein four isoforms identified in mammals: MT-I, MT-II, MT-III and MT-IV diverse functions -metal ion homeostasis -heavy metal sequestration -protection from oxidative damage -metal reservoir Gwen Jordaan
Metallothionein • dumbbell shape, cysteine-rich • domain and domain • clusters of metal ions www.unizh.ch/~mtpage/into.html Gwen Jordaan
Metallothionein • Zinc-thiolate clusters • Eo very low Fischer et al., Proc.Natl.Acad.Sci. 1998 Maret, W. Am.Soc.Nutr.Sci 2000 Gwen Jordaan
Metallothionein Regulation regulation – transcriptional level induction – metals, oxidants,cytokines, hormones metal induction- metal responsive elements (MREs) MREs- conserved core sequence TGC(G/A)CNC metal transcription factor, MTF-1 regulates expression - binding to MRE - activity induced by metals but needs zinc to bind to MRE Gwen Jordaan
Metallothionein Regulation Gwen Jordaan
Artemia • brine shrimp – Artemia salina Nauplius Adult http://www.captain.at/artemia/ http://www.acuariolasmercedes.com/Guia-de-cuidado/artemia-salina-brine-shrimps-introducion-1.htm Gwen Jordaan
Metallothionein Why Artemia? small, easy to grow, and relatively cheap to purchase embryonic development extensively studied biomarker for heavy metal contamination in aquatic ecosystems -phthalate ester embryotoxicity four Artemia MT isoforms identified coding region of one of the isoforms sequenced Gwen Jordaan
Metallothionein Goal: isolate and sequence the promoter region, ID position and number of MREs, and determine extent of promoter activity when induced by heavy metals - experiment design will determine if four isoforms regulated by one promoter, or if each isoform is regulated by its own promoter Gwen Jordaan
Metallothionein • coding sequence of Artemia MT isoform 5’ATGGACTGCTGCAAGAACGGTTGCACCTGTGCCCCAAATTGCAAATGTGCC Start asp cys cys lys asn gly cys thr cys ala pro asn cys lys cys ala AAAGACTGCAAATGCTGCAAAGGTTGTGAGTGCAAAAGCAACCCAGAATGC lys asp cys lys cys cys lys gly cys glu cys lys ser asp pro glu cys AAATGTGAGAAGAACTGTTCATGCAACTCATGTGGTTGTCACTGA3’ lys cys glu lys asn cys ser cys asn ser cys gly cys hisStop Gwen Jordaan
Methods and Materials Genomic DNA digested with restriction enzymes DNA walking method- amplification of an unknown sequence adjacent to a known sequence - • touchdown PCR – annealing/extension temperature is higher than Tm of the primers Gwen Jordaan
Methods and Materials DNA walking Clone into vector clone into GFP reporter gene Send for sequencing generate MT promoter- ID MREs GFP constructs transfect into COS cells treat with nM metal concentrations for 24h incubation measure fluorescence Gwen Jordaan
Methods and Materials • MT-GFP constructs showing deletions MT-GFP vector GFP Gwen Jordaan
induction by Zn greater than Cd • extent of induction decreased as MREs removed Expected Results Gwen Jordaan
Future Perspectives • 4 promoters for 4 isoforms or 1 promoter for 4 isoforms - expression is tissue-specific - differential expression due to environmental factors • cooperative interaction among MREs • promoter sequenced other regulatory elements can be identified and studied -ARE/USF – oxidative stress Gwen Jordaan
Acknowledgements Dr Acey (Research Mentor) HHMI Dr Mason (Instructor) Gwen Jordaan