150 likes | 155 Views
Mutations Changes to DNA. TACGCACATTTACGTACG. DNA. aa. aa. aa. aa. aa. aa. aa. AUG CGU GUA AAU GCA UGC. mRNA. protein. trait. Mutations. Changes to DNA are called ______________ change the DNA changes the mRNA may change protein may change trait. Types of mutations.
E N D
Mutations Changes to DNA
TACGCACATTTACGTACG DNA aa aa aa aa aa aa aa AUGCGUGUAAAUGCAUGC mRNA protein trait Mutations • Changes to DNA are called ______________ • change the DNA • changes the mRNA • may change protein • may change trait
Types of mutations • Changes to the letters (A,C,T,G bases) in the DNA • ____________________________ • change to ONE letter (base) in the DNA • may cause change to protein, may not • ____________________________ • addition of a new letter (base) in the DNA sequence • deletion of a letter (base) in the DNA • both of these shift the DNA so it changes how the codons are read • big changes to protein!
Point Mutations • One base change • can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN
Point Mutations • __________________= changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Doesthis changethe protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
Sickle cell anemia • Hemoglobin protein in red blood cells • strikes 1 out of 400 African Americans • limits activity, painful & may die young Normalround cells Misshapensickle cells Only 1 out of146 amino acids
Point Mutations • __________________= no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? Why not? The code hasrepeats in it! AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
Point Mutations • __________________= change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyedthat protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop
Frameshift Mutations • Add or delete one or more bases • changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN
Frameshift Mutations • __________= add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
Frameshift Mutations • __________= lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
Cystic fibrosis • Broken salt channel in cells • strikes 1 in 2500 white births • gene codes for a protein channelthat allows salt to flow across cell membrane • broken protein doesn’t work as channel • doesn’t allow salt out of cell, so water doesn’t flow out either • thicker & stickier mucus coating around cells • mucus build-ups in lungs & causes bacterial infections • destroys lung function • without treatment children die before 5; with treatment can live past their late 20s
Salt channel transports salt through protein channel out of cell Osmosis problems! Effect on Lungs normal lungs airway salt salt channel normal mucus H2O cells lining lungs cystic fibrosis salt thick mucus H2O mucus & bacteria build up= lung infections & damage
Deletion leads to Cystic fibrosis deletion Loss of one amino acid!