1 / 119

What Perl can do for you Or What you can do with Perl Paul Boddie Biotechnology Centre of Oslo

What Perl can do for you Or What you can do with Perl Paul Boddie Biotechnology Centre of Oslo MBV 3070 May 2009 (Originally given by Ian Donaldson, April 2007) ‏ http://donaldson.uio.no/wiki/MBV3070. Much of the material in this lecture is from the

liesel
Download Presentation

What Perl can do for you Or What you can do with Perl Paul Boddie Biotechnology Centre of Oslo

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. What Perl can do for you Or What you can do with Perl Paul Boddie Biotechnology Centre of Oslo MBV 3070 May 2009 (Originally given by Ian Donaldson, April 2007)‏ http://donaldson.uio.no/wiki/MBV3070

  2. Much of the material in this lecture is from the “Lecture to Programming – Exercises” developed for the Canadian Bioinformatics Workshops by Sohrab Shah Sanja Rogic Boris Steipe Will Hsiao And released under a Creative Commons license

  3. http://creativecommons.org/licenses/by-sa/2.5/

  4. This lecture is a crash course in the Perl programming language and roughly covers the same material as the perlintro at http://perldoc.perl.org. It is meant to complement the lab work that follows the “Beginning Perl” tutorial at http://www.perl.org/books/beginning-perl/

  5. This lecture Why program? Why Perl? What is Perl? Getting Started With Perl Basic Syntax Perl variable types Conditional and looping constructs Built-in operators and functions Files and I/O Regular Expressions Subroutines

  6. Steps to create and run a Perl program • Create a directory called “my_perl” > mkdir my_perl • Change into “perl_one” directory > cd my_perl • Open file “myscript1.pl” in text editor > notepad myscript1.plx • Write and save your program • Change the permissions (if you are on a unix platform)‏ • Run it! > perl myscript1.plx This starts a program called notepad This starts a program called perl

  7. Parts of a Perl Program Path to the Perl interpreter #!/usr/bin/perl #This is a very simple program that prints #“My first Perl program” to the screen #Print “My first Perl program” followed by a new #line to the screen print(“My first Perl program\n”); Comments get ignored by the interpreter All statements must be syntactically correct (eg semi-colon)‏ Statements are the instructions of your program

  8. Parts of a Perl program • Interpreter line • This tells the operating system where the Perl interpreter is sitting • Every Perl program must have this line • Comments • Lines that begin with ‘#’ that are ignored by the interpreter • Used to document the program • Extremely important in deciphering what the statements in the program are supposed to do • Statements • Instructions of the program • Follow a strict syntax that must be learned by the programmer • Ill-formatted statements will prevent your program from running

  9. Basic Perl syntax print "Hello, world"; #this is a comment print “Hello world” ;

  10. Exercise 1 • Task • print something to the screen • Concepts • structure of a program • perl interpreter line • comments • statements

  11. Syntax Exercise 1 #!/usr/bin/perl use strict; use warnings; print "My first Perl program\n"; #try single quotes print "First line\nsecond line and there is a tab\there\n";

  12. Common errors • ‘Command not found’ • Is perl is your $PATH ? • ‘Can't find string terminator '"' anywhere before EOF’ • Did you close the quotation marks? • Did you remember the semi-colon?

  13. How does Perl represent data? • Most data we will encounter is the form of numbers or strings (text)‏ • These are known as scalars • Numbers • Integers, real, binary... • Strings • Any text including special characters enclosed in single or double quotes

  14. Numbers 7 3.14159 -0.00004 3.04E15 Perl supports scientific notation

  15. Strings “This is a string” ‘This is also a string’ “ACGACTACGACTAGCATCAGCATCAG”

  16. Special characters for strings • Strings can contain special characters for things like tab and newline • These characters need to be escaped with a backslash • \t means tab • \n means newline • These characters do not get interpreted inside single quotes “There is a newline \n here” “Put a tab\t here” ‘Is there a \t tab here?’ No tab because \t will not be interpreted inside single quotes

  17. Variables: how to store data in memory • A variable is a ‘container’ that lets you store data • Every variable has a name that acts as a label on the data it is storing • Variable names begin with a dollar sign followed by an alphanumeric name that may contain underscores • First character after the dollar sign must be a letter • $x, $this_variable, $DNA, $DNA2 • To store information in a variable, use the assignment operator ‘=‘

  18. Variables in action $myNumber = 7; Assignment operator 7 myNumber

  19. Using arithmetic operators $sum = 3 + 4; $difference = 4 – 3; $product = 4 * 3; $quotient = 4 / 3; $mod = 4 % 3; $power = 4**3; $total = (4+3)*4-8; Precedence follows rules of arithmetic

  20. Increment/Decrement • Other handy operators on integer variables $var = 1; $var++; # $var now equals 2 $var--; # $var now equals 1

  21. Variable interpolation • Substituting the name of a variable for its value in a double-quoted string • Useful for printing out the value of a variable $myVariable = 7; print “The value of my variable is: $myVariable\n”; The value of my variable is: 7 Variables only get interpolated inside double-quoted strings

  22. Variable interpolation • What about variables inside single-quoted strings? $myVariable = 7; print ‘The value of my variable is: $myVariable\n’; The value of my variable is: $myVariable Variables do not get interpolated inside single-quoted strings

  23. Exercise 2 • Task • use numerical operators • print interpolated variables to the screen • Concepts • using numerical operators • variable interpolation

  24. Exercise 2 - Functions • print ITEM1, ITEM2, ITEM3, ... • Prints a list of variables, numbers, strings to the screen • The list might only contain one item

  25. Syntax Exercise 2 #!/usr/bin/perl use strict; use warnings; #assign values to variables $x and $y and print them out my $x = 4; my $y = 5.7; print "x is $x and y is $y\n"; #example of arithmetic expression my $z = $x + $y**2; $x++; print "x is $x and z is $z\n"; #evaluating arithmetic expression within print command print "add 3 to $z: $z + 3\n"; #did it work? print "add 3 to $z:", $z + 3,"\n";

  26. Variables can also store strings $myString = “ACGT”; “ACGT” myString

  27. The value of a variable can be changed $myString = “ACGT”; $myString = “ACGU”; “ACGT” “ACGU” myString Variables are so named because they can take on different values.

  28. String operators • Strings, like numbers also have operators • Concatenation is done with ‘.’ The dot operator stitches strings to the left and right of it together into a new string $exon1 = “ATGTGG”; $exon2 = “TTGTGA”; $mRNA = $exon1 . $exon2; print “The 2 exon transcript is: $mRNA \n”; The 2 exon transcript is: ATGTGGTTGTGA

  29. String operators • How do I find the length of my string? • Perl provides a useful function called...length We’ll go into functions in more detail later on $DNA = “ACGTG”; $seqLength = length ($DNA); print “my sequence is $seqLength residues long\n”; my sequence is 5 residues long

  30. String operators • How do I extract a substring (part of) of a string? • Use the substr function $longDNA = “ACGACTAGCATGCATCGACTACGACTACGATCAGCATCGACTACGTTTTAGCATCA” $shortDNA = substr ($longDNA, 0, 10); print “The first 10 residues of my sequence are: $shortDNA\n”; String from which to extract the substring Length of the substring Start from this position – Perl starts counting from 0 The first 10 residues of my sequence are: ACGACTAGCA

  31. String operators • How do you find the position of a given substring in a string? • Find the position of the first ambiguous “N” residue in a DNA sequence • This can be done with the index function The string to search $DNA = “AGGNCCT”; $position = index ($DNA, “N”); print “N found at position: $position\n”; The substring to search for index returns -1 if substring is not found N found at position: 3 Perl starts counting from 0

  32. Exercise 3 • Task • concatenate two strings together and calculate the new string’s length • extract a substring from the new string • Concepts • string operators and functions

  33. Functions in Exercise 3 • STRING1 . STRING2 • concatenate two strings • length (VARIABLENAME)‏ • returns the length of a string • substr (VARIABLENAME, START, LENGTH)‏ • returns a substring from VARIABLENAME starting at position START with length LENGTH

  34. Variables - recap • Variables are containers to store data in the memory of your program • Variables have a name and a value • The value of a variable can change • In Perl, variables starts with a ‘$’ and values are given to it with the ‘=‘ operator

  35. I/O 2: Inputting data into variables • So far we have ‘hard coded’ our data in our programs • Sometimes we want to get input from the user • This is done with the ‘<>’ operator • <STDIN> can be used interchangeably • This allows your program to interact with the user and store data typed in on the keyboard $input = <>; print “You typed $input\n”;

  36. I/O 2: Inputting data into variables • Extra newline character? • When using <>, the new line character is included in the input • You can remove it by calling chomp $input = <STDIN>; chomp ($input); print “$input was typed\n”;

  37. #!/usr/bin/perl use strict; use warnings; #TASK: Concatenate two given sequences, #find the length of the new sequence and #print out the second codon of the sequence #assign strings to variables my $DNA = "GATTACACAT"; my $polyA = "AAAA"; #concatenate two strings my $modifiedDNA = $DNA.$polyA; #calculate the length of $modifiedDNA and #print out the value of the variable and its length my $DNAlength = length($modifiedDNA); print "Modified DNA: $modifiedDNA has length $DNAlength\n"; #extract the second codon in $modifiedDNA my $codon = substr($modifiedDNA,3,3); print "Second codon is $codon\n"; Syntax Exercise 3

  38. Exercise 4 • Task • get a users name and age and print their age in days to the screen • Concept • getting input from the user

  39. Exercise 4 • <> • get input from the keyboard • chomp (VARIABLENAME)‏ • removes the newline character from the end of a string

  40. #!/usr/bin/perl use strict; use warnings; #TASK: Ask the user for her name and age #and calculate her age in days #get a string from the keyboard print "Please enter your name\n"; my $name = <STDIN>; #getting rid of the new line character #try leaving this line out chomp($name); #prompt the user for his/her age #get a number from the keyboard print "$name please enter your age\n"; my $age = <>; chomp($age); #calculate age in days my $age_in_days = $age*365; print "You are $age_in_days days old\n"; Syntax Exercise 4

  41. Arrays • Arrays are designed to store more than one item in a single variable • An ordered list of data (1, 2, 3, 4, 5)‏ (“Mon”, “Tues”, “Wed”, “Thurs”, “Fri”)‏ ($gene1, $gene2, …)‏ • Array variables start with ‘@’ @myNumbers = (1, 2, 3, 4, 5); @myGenes = (“gene1”, “gene2”, “gene3”);

  42. Array operators – [ ] • Accessing the individual elements of an array is done with the square brackets operator – [ ] @myNumbers = (“one”,”two”,”three”,”four”); $element = $myNumbers[0]; print “The first element is: $element\n”; When using the [] operator, the index of the element you want goes in the brackets When using the [] operator to access an element, the ‘@’ changes to a ‘$’ because elements are scalars The first element is: one

  43. Array functions - scalar • How do I know how many elements are in my array? • use the scalar function @myNumbers = (“one”,”two”,”three”,”four”); $numElements = scalar (@myNumbers); print “There are $numElements elements in my array\n”; There are 4 elements in my array

  44. Array functions - reverse • You can reverse the order of the elements in an array with reverse @myNumbers = (“one”,”two”,”three”,”four”); @backwards = reverse(@myNumbers); print “@backwards\n”; four three two one

  45. Exercise 5 • Task • create an array and access its elements • Concepts • declaring an array • square bracket operator • array functions • array variable interpolation

  46. Exercise 5 • $ARRAYNAME[ INDEX] • accesses individual element of the array indexed by INDEX • remember indexes start from 0 • precede ARRAYNAME with ‘$’ • scalar (ARRAYNAME)‏ • returns the number of elements in the array

  47. Arrays - recap • Arrays are used to store lists of data • Array names begin with ‘@’ • Individual elements are indexed and can be accessed with the square bracket operator • use ‘$’ for the variable name! • Numerous functions exist to manipulate data in arrays

  48. #!/usr/bin/perl use strict; use warnings; #initialize an array my @bases = ("A","C","G","T"); #print two elements of the array print $bases[0],$bases[2],"\n"; #print the whole array print @bases,"\n"; #try with double quotes #print the number of elements in the array print scalar(@bases),"\n"; Syntax Exercise 5

More Related