1 / 11

A Viral Metagenome Analysis

By: Kristyn Sennett. A Viral Metagenome Analysis. Background. Viral metagenome used to get a comprehensive look at a viral community Schoenfield et al. gathered thermophilic viruses from Yellowstone National Park hotsprings

lulul
Download Presentation

A Viral Metagenome Analysis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. By: Kristyn Sennett A Viral Metagenome Analysis

  2. Background • Viral metagenome used to get a comprehensive look at a viral community • Schoenfield et al. gathered thermophilic viruses from Yellowstone National Park hotsprings • Viral DNA was extracted, purified and a linker was added for ease of primer use • DNA was fragmented, amplified, and inserted into a pSMART vector

  3. Preparation for Analysis • Reads were received through the BioBike portal • Reads were edited to remove artifacts of the linkers used in the amplification process • Reads were Blasted against other reads from the same metagenome

  4. The Reads OctHS.atyb5119-g2 • Octopus Metagenome • 996 bases in length after editing OctHS.atyb5119-b2 • Octopus Metagenome • 1001 bases in length after editing Did not overlap with one another

  5. OctHSe.atyb5119-b2 • No overlaps with other reads to make a longer contiguous read • Significantly matched OctHSe.atyb3565-g2 indicates from a related virus but not the same virus atyb5119-b2 518 579 622 667 706 1 721 203 163 120 87 48 atyb3565-g2

  6. OctHS.atyb5119-g2 • No overlaps with other reads to make a large contiguous read • A specific sequence of about 36bases around coordinates 341 to 370 was found to be repeated several times in two other reads: atyb2687-g2 and atyb2687-b2

  7. Repeated Sequence Coordinates in atyb2687-g2: 22-52 91-119 155-185 221-249 287-317 354-382 419-449 490-512 Coordinates atyb2687-b2: 575-547 511-482 445-415 380-351 311-383 245-217 180-151 114-86 86-58 50-21 AACTTTCAACTCCACACGGTACATTAGGAACCC

  8. Repeated Sequence • Nothing out of the ordinary with the sequence • nBLAST returned no conclusive results

  9. OctHSe.atyb2687 g2 and b2 • Repeated sequence only found in the first half of each read • Reads showed no other strange features • The sequences between each repeated sequence showed no unusually features

  10. Further Research • Look more in depth at the two reads with the repeated sequence • See if that repeated sequence is found in any other thermophilic viruses or other viruses in general • Find out what that repeated sequence means in a virus

  11. Works Cited • Shoenfield T., M. Patterson, P. Richardson, K.E. Wommack, M. Young, D. Mead, 2008 Assembly of Viral Metagenomes from Yellowstone Hot Springs. Applied and Environmental Microbiology 74: 4164-4174. • NCBI: http://www.ncbi.nlm.nih.gov/ accessed on 5 May 2009.

More Related