110 likes | 119 Views
By: Kristyn Sennett. A Viral Metagenome Analysis. Background. Viral metagenome used to get a comprehensive look at a viral community Schoenfield et al. gathered thermophilic viruses from Yellowstone National Park hotsprings
E N D
By: Kristyn Sennett A Viral Metagenome Analysis
Background • Viral metagenome used to get a comprehensive look at a viral community • Schoenfield et al. gathered thermophilic viruses from Yellowstone National Park hotsprings • Viral DNA was extracted, purified and a linker was added for ease of primer use • DNA was fragmented, amplified, and inserted into a pSMART vector
Preparation for Analysis • Reads were received through the BioBike portal • Reads were edited to remove artifacts of the linkers used in the amplification process • Reads were Blasted against other reads from the same metagenome
The Reads OctHS.atyb5119-g2 • Octopus Metagenome • 996 bases in length after editing OctHS.atyb5119-b2 • Octopus Metagenome • 1001 bases in length after editing Did not overlap with one another
OctHSe.atyb5119-b2 • No overlaps with other reads to make a longer contiguous read • Significantly matched OctHSe.atyb3565-g2 indicates from a related virus but not the same virus atyb5119-b2 518 579 622 667 706 1 721 203 163 120 87 48 atyb3565-g2
OctHS.atyb5119-g2 • No overlaps with other reads to make a large contiguous read • A specific sequence of about 36bases around coordinates 341 to 370 was found to be repeated several times in two other reads: atyb2687-g2 and atyb2687-b2
Repeated Sequence Coordinates in atyb2687-g2: 22-52 91-119 155-185 221-249 287-317 354-382 419-449 490-512 Coordinates atyb2687-b2: 575-547 511-482 445-415 380-351 311-383 245-217 180-151 114-86 86-58 50-21 AACTTTCAACTCCACACGGTACATTAGGAACCC
Repeated Sequence • Nothing out of the ordinary with the sequence • nBLAST returned no conclusive results
OctHSe.atyb2687 g2 and b2 • Repeated sequence only found in the first half of each read • Reads showed no other strange features • The sequences between each repeated sequence showed no unusually features
Further Research • Look more in depth at the two reads with the repeated sequence • See if that repeated sequence is found in any other thermophilic viruses or other viruses in general • Find out what that repeated sequence means in a virus
Works Cited • Shoenfield T., M. Patterson, P. Richardson, K.E. Wommack, M. Young, D. Mead, 2008 Assembly of Viral Metagenomes from Yellowstone Hot Springs. Applied and Environmental Microbiology 74: 4164-4174. • NCBI: http://www.ncbi.nlm.nih.gov/ accessed on 5 May 2009.