110 likes | 329 Views
Macugen ( pegaptanib ). Treats wet age-related macular degenration Pegylated nucleic acid Antiangiogenic : Stops vascular overgrowth Other options, but does not reverse Avastin (colon cancer drug) Lucentis (can actually restore vision—more common). Macugen – Macular Deneration.
E N D
Macugen (pegaptanib) • Treats wet age-related macular degenration • Pegylated nucleic acid • Antiangiogenic: Stops vascular overgrowth • Other options, but does not reverse • Avastin (colon cancer drug) • Lucentis (can actually restore vision—more common)
Macugen – Macular Deneration • wet Age-Related Macular Degeneration (ARMD) • Overexpression of protein VEGF 165: Vascular Endothelial Growth Factor • → vasculature crowds out photoreceptors
Macugen – Active Ingredient • Aptamer – Anti-VEGF nucleic acid (50 kilodaltons) • (CGGAAUCAGUGAAUGCUUAUACAUCCG) • Binds to VEGF, preventing function (similar to other antiangiogenics; different molecule class)
Macugen – Active Ingredient • ((2'-deoxy-2'-fluoro)C-Gm-Gm-A-A-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-Am-Gm-(2'-deoxy-2'-fluoro)U-Gm-Am-Am-(2'-deoxy-2'-fluoro)U-Gm-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)U-Am-(2'-deoxy-2'-fluoro)C-Am-(2'-deoxy-2'-fluoro)U-(2'-deoxy-2'-fluoro)C-(2'-deoxy-2'-fluoro)C-Gm-(3'→3')-dT), 5'-ester with α,α'-[4,12-dioxo-6-[[[5-(phosphoonoxy)pentyl]amino]carbonyl]-3,13-dioxa-5,11-diaza-1,15-pentadecanediyl]bis[ω-methoxypoly(oxy-1,2-ethanediyl)], sodium salt.
Macugen – Treatment • Technique: • Local anesthetic and antimicrobial • Intravitreal injection (“slight pressure”, but no pain) • Dose: 0.3 mg (1.6 mg pegylated) • Volume: 90 µL (pre-filled syringe) • Short-term effects • Cloudy vision • Tiny air bubble in eye • Itchiness/soreness
Macugen – Formulation • Drug provided as sodium salt • Coated in polyethylene glycol to reduce immune response and size in solution • Inactive ingredients: • , (Counterions for drug/salt) • /(pH adjustment)
Macugen – How Does It Work? Vascular Endothelial Growth Factor (VEGF): a signal protein that stimulates vasculogenesis and angiogenesis. Angiogenesis:the physiological process involving the growth of new blood vessels from pre-existing vessels.
Macugen – History • Discovered by Gilead Sciences • Liscensed to EyeTech Pharmaceuticals (Now OSI Pharmaceuticals) for late stage development and marketing in the U.S. • Marketed by Pfizer outside of the U.S. • Approval Granted by the U.S. Food and Drug Administration (FDA) in December, 2004.
Macugen – Deficiencies • Serious side effects may include detached retinas, endophthalmitis(< 1%) • Less serious side effects include eye floaters, discomfort, slightly increased intravitrealpressure, infection, or allergic reaction(≤ 40%)
Macugen – Alternative Therpies • Implantable Telescope • Lucentis • Avastin • Visudyne Drug Treatment or Photodynamic Therapy (PDT) • Laser Treatment