1 / 7

LGMD 2I (FKRP) - Klinikai tünetek

LGMD 2I (FKRP) - Klinikai tünetek. 31 éves nôbeteg Gyermekkori fejlôdés normális, elsô tünetek 14 éves korban: enyhe proximális lábizomgyengeség, lépcsön járás nehezített

melodie-levine
Download Presentation

LGMD 2I (FKRP) - Klinikai tünetek

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. LGMD 2I (FKRP) - Klinikai tünetek • 31 éves nôbeteg • Gyermekkori fejlôdés normális, elsô tünetek 14 éves korban: enyhe proximális lábizomgyengeség, lépcsön járás nehezített • Sarkonjárás enyhén nehezitett, egyébként a járás normális. Combizmok mko 4/5, peronealis izmok 4/5, vadli hypertrophia, felálláskor Gowers jel. • EMG enyhén myopathiás, CK 2500 U/l (normál<80 U/l) • Szív és légzésfunkció normális

  2. LGMD 2I (FKRP def)

  3. Kontrolle LGMD2I Immunhisztokémia Merosin -DG

  4. LGMD 2I - Genetika A A L L R A L G I R L V S W E G G R L E Wildtyp: ggcggcgctgctccgcgcgctgggcatccgcatagtgagctgggaaggcgggcggctgga beteg: ggcggcgctgctccgcgcgctgggcatccgcctagtgagctgggaaggcgggcggctgga A A L L R A L G I R I V S W E G G R L E beteg: C826A homozygota (Leu276Ile) apa C826A heterozygota anya C826A heterozygota testvér C826A heterozygota

  5. MDC 1C – LGMD 2I súlyos Tyr307Asn Tyr307Asn DMD-like Leu276Ile Tyr307Asn enyhe Leu276Ile Leu276Ile

  6. LGMD 2 I Fenotípus

  7. LGMD 2I (Leu276Ile) • Kezdeti életkor kb. 30 év • kacsázó járás, lépcsôn járás nehezített, hypotonia • proximális túlsúlyú izomgyengeség, lábak > karok • vádlihypertrophia gyakori • kísérô izomgörcsök, myoglobinuria, rhabdomyolysis • kardialis és respiratorikus érintettség elôfordulhat • CNS érintettség ?

More Related