1 / 37

Mutation Detection: Answers

Mutation Detection: Answers. Original DNA sequence GGC [TAC GAGCTTCGAAATTTGCCG ATC] CCA mRNA:AUG – CUC – GAA – GCU – UUA – AAC – GGC – UAG A.A.s MET – LEU – GLU – ALA - LEU – ASP – GLY – STOP

mkitchen
Download Presentation

Mutation Detection: Answers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mutation Detection: Answers • Original DNA sequence • GGC[TACGAGCTTCGAAATTTGCCGATC]CCA • mRNA:AUG – CUC – GAA – GCU – UUA – AAC – GGC – UAG • A.A.s MET – LEU – GLU – ALA - LEU – ASP – GLY – STOP • Identify the reading frame by transcribing the DNA & identifying the start codon. Then group the codons in 3’s until you reach the stop codon. • Mutant one: FRAMESHIFTthe original reading frame is affectedGGCTACGAGCTTCGAAAATTTGCCGATCCCA… Homework • Mutant 2: NONSENSEan internal stop codon is inserted GGCTACGAGCTTCGAACTTTGCCGATCCCA • Mutant 3: MISSENSE a new amino acid is made with the mutationGGCTACGAGCCTCGAAATTTGCCGATCCCA • Mutant 4: SILENT the gene isn’t affected as GAC & GAG both code for the same amino acidGGCTACGACCTTCGAAATTTGCCGATCCCA UUU – AAA – CGG – CUA – GGG  MET – LEU – GLU – ALA – PHE – LYS – ARG – LEU – GLY MET – LEU – GLU – ALA – STOP MET – LEU – GLU – ALA – GLU  GLY MET – LEU – GLU – ALA – LEU  LEU

  2. Intro • You all learned in MITOSIS that cells reproduce through the process of cell division. • This includes mitosis & cytokinesis • The process creates 2 identical daughter cells, also called clones for the reasons of replacing, growing the # of, and repairing our body’s cells. • In this lesson you are going to learn the processes by which organisms reproduce. • Next you’ll learn how gametes form… through meiosis.

  3. Common Sense • “The chief function of the reproductive system is to ensure survival of the species.” • http://www.daviddarling.info/encyclopedia/R/reproductive_system.html • You all should know by now that, for humans, it takes a mom and a dad to produce a baby through the mechanism of sex. • But questions we must answer: • Is this the only way organisms reproduce? • How do each of the methods that satisfy the need to reproduce work? (in general) • Why do the methods work? • What are the advantages and disadvantages?

  4. Objectives. Organism Reproduction • Compare the genetics of offspring in asexual reproduction with the parent. • Describe how the offspring in sexual reproduction compare genetically with the parent. • Chromosome Number Objectives: • Explain why chromosomes are important to an organism. • Compare the number of sets of chromosomes between a haploid cell and a diploid cell. • Create a karyotype to determine chromosome number.

  5. Vocabulary • Gamete • Zygote • Diploid • Haploid • Homologous chromosome

  6. Asexual Reproduction • In asexual reproduction (like MITOSIS) a single parent passes a complete copy of its genetic information to each of its offspring. • The offspring formed by asexual reproduction are genetically identical to its parent. • Clones… • Asexual reproduction is broken down into (at least) 4 types: • Binary fission • Fragmentation • Budding • Parthenogenesis

  7. Asexual Reproduction • Binary Fission. • Similar to MITOSIS without the nucleus. • One parent splits into two genetically identical offspring. • Like bacteria. • Many unicellular eukaryotes also reproduce asexually. • Amoeba…for example

  8. Asexual Reproduction • Some multicellular eukaryotes, such as starfish or Planarian, go through fragmentation. • Fragmentation is a kind of asexual reproduction in which the body breaks into several pieces. Each piece can grow into a new organism.

  9. Asexual Reproduction • Other animals, such as the hydra or a potato, go through budding. • In budding, new individuals split off from existing ones. • Other plants can reproduce from roots or leaves.

  10. Asexual Reproduction • Parthenogenesisis a process in which a female makes a viable egg that grows into an adult without being fertilized by a male. • Ex. • Aphids (pictured) • Water fleas • Boas • Komodo dragons • Sharks • Others.

  11. Check for Understanding • What are 4 types of asexual reproduction we discussed so far? • 1. binary fission • 2. fragmentation • 3. budding • 4. parthenogenesis • List the appropriate definition next to the word • A. a viable egg produced by the mother that grows into an adult without fertilization • B. new individuals split off from existing ones • C. body breaks into several pieces • D. reproduction through cell division • Answers: d, c, b, a

  12. Sexual Reproduction Multicellular Organisms have two types of cells. • Somatic cells: Body cells. • Skin cells, muscle cells, nerve cells, etc. • These grow in number through MITOSIS. • Somatic cells do not participate in sexual reproduction. • Germ cells: Cells that are created for sexual reproduction • Examples: Sperm, egg, pollen, spores • These undergo MEIOSIS division to create gametes. • Only germ cells can produce gametes.

  13. Sexual Reproduction • Most eukaryotic organisms reproduce sexually. • In sexual reproduction, gametes from genetically different parents produce offspring that are a genetic hybrid of the parents. • Each parent produces a reproductive cell, called a gamete. • Male Gamete = sperm • Female Gamete = egg • Gametes fuse during fertilization to form a zygote. • The zygote then develops through mitosis into an organism. • Because both parents give genetic material, the offspring has traits of both parents but is not exactly like either parent.

  14. Sexual • Offspring - Genetically varied • Asexual • Offspring - Genetically identical Germ cell Meiosis Gametes • Egg • Sperm • Pollen • Spore Fertilization Zygote ♀ ♂ Parent Offspring • Cellular reproduction = MITOSIS • Asexual Reproduction • Binary fission • Fragmentation • Budding • Parthenogenesis

  15. Reproduction • We have learned the two types of reproduction. • They are: • 1. Asexual • 2. Sexual • How do the offspring produced from each of these types of reproduction compare to its parent? • Asexual = they are genetically identical • Sexual = they are genetically different (but express traits from both parents)

  16. Asexual Reproduction

  17. Sexual Reproduction

  18. Why is Genetic Variability A Benefit? • Sexual reproduction is only beneficial if it creates a wide variety of traits in offspring. • Variation creates possibilities for the species to survive changing environments. • Fundamental in Natural Selection & Evolution.

  19. In Summary. Genetic Variation from Sexual Reproduction. • Asexual Reproduction is efficient but doesn’t change the genetics of a population. • Can reproduce quickly but they all have the same traits. • Sexual Reproduction is less efficient but does change the genetics of a population. • Reproduce slower but some born are better prepared to survive than others.

  20. Part II Chromosome Number • Organisms are organized by how they reproduce. • They are also organized by their chromosome arrangement.

  21. Chromosomes • Each species has a specific arrangement of chromosomes, both numbers and sizes. • Chromosome • Large (sometimes millions of nucleotides long) • Continuous (it is one or two strands, unbroken) • Contains all genes (part encode for proteins) • An organism is part of a species if it has the same number of chromosomes as other members of the species.

  22. Chromosome Number of Various Organisms

  23. Chromosome Number • Every organism has a specific number of chromosomes and sets. • The arrangement of chromosomes can be determined by observing the karyotype of the organism. • We’ll see this again soon, but for now look at yours.

  24. What is ‘n’? • b. ‘n’ = the number of chromosomes in one set. • a. The number of chromosomes in an organism or cell is determined by inheritance patterns. • Asexual or sexual • What the parent(s) has the offspring has. • Ex. Humans have 23 chromosomes in one set. • Each parent contributes one set so humans have 2 sets of 23, for a total 46 chromosomes. • ‘n’ for humans is 23. • It is written 2n = 46 • Literal translation = human cells have 2 sets of chromosome, 46 in total. • We could calculate the number of chromosomes in a set using simple math (divide by 2)

  25. Decide • Here we have a karyotype from a human. • How many chromosomes are there? • How many chromatids? • Are these chromosomes duplicated or single copy? • How many sets? • How many in one set? • Human gametes have 23 chromosomes in their sets, so for humans n = 23.

  26. Chromosome Number Haploid and Diploid Cells • c. If a cell has one set of chromosomes it’s considered haploid. • Describes a cell, nucleus, or organism that has only one set of unpaired chromosomes • d. A cell, such as a somatic cell, that has two sets of chromosomes is diploid. • A cell that contains 2 haploid sets of chromosomes • There does exist a third kind, polyploid, which can have many more than two copies of each chromosome. Polyploid types are labeled according to the number of chromosome sets in the nucleus: triploid (three sets; 3x), for example the phylumTardigrada[3] tetraploid (four sets; 4x), for example Salmonidae fish pentaploid (five sets; 5x), for example hexaploid (six sets; 6x), for example wheat, kiwifruit[4] octaploid (eight sets; 8x), for example Acipenser (genus of sturgeon fish) decaploid (ten sets; 10x), for example certain strawberries dodecaploid (twelve sets; 12x), for example the plant Celosia argentea and the amphibian Xenopus ruwenzoriensis

  27. Chromosome Number Haploid and Diploid Cells • f. Recall: In organisms that reproduce with two parents there are two types of cells. • g. Somatic cells (also called body cells) • h. Muscle, nerve, etc. • i. Somatic cells are diploid (in humans) • Germ cells (sex cells) are also diploid, but they undergo meiosis, which creates gametes. • j. Gametes are also called reproductive cells. • k. Sperm, egg, pollen, spores. • l. Gametes are haploid, meaning they have one set of chromosomes.

  28. From Dad Chromosome Types • From Mom • The same genes but usually different versions. Homologous Chromosomes • m. Each diploid cell has pairs of chromosomes made up of two homologous chromosomes. • n. Homologous chromosomesare chromosomes that are similar in size, in shape, and in kinds of genes. • Each chromosome in a homologous pair comes from one of the two parents. • Homologous chromosomes can carry different forms of the same genes. • Mom may have the black hair gene where dad could have blond.

  29. Chromosome Types Autosomes and Sex Chromosomes • In a nucleus, there are two types of chromosomes. • p. Autosomesare chromosomes with genes that do not determine the sex of an individual. • What are these genes? • q. Sex chromosomes have genes that determine the sex of an individual.

  30. Chromosome Types Autosomes and Sex Chromosomes • In humans and many other organisms, the two sex chromosomes are referred to as the X and Y chromosomes. • The genes that cause a zygote to develop into a male are located on the Y chromosome. • r. Human males have one X chromosome and one Y chromosome (XY), • s. and human females have two X chromosomes (XX).

  31. Summary • Tell me: • What are the 4 types of asexual reproduction? • As a result of asexual reproduction, how do offspring compare to their parents? • How do offspring of sexual reproduction compare to their parents? • What does haploid mean? • What does diploid mean?

  32. Summary • This is a karyotype. • Tell me what homologous chromosomes are. • Does this show a haploid or diploid organism? • What is this individual’s haploid number? • n = • What is this individual’s diploid number? • 2n =

  33. What’s Next? • Now that you have the necessary information you will begin to explore the process of meiosis. • You will have these assignments to help you practice with it. • Today: Meiosis Notes. Read and Research the steps and highlights of meiosis in groups. • By Monday: Complete the Meiosis Web Lesson. • Pay really close attention to the web lesson. Go through it several times to completely understand it. • By Monday: Have read and outlined CH10

  34. The Benefit of Diversity • EX: Variation in eye color provides different benefits. • Eye color has a direct correlation to absorbing sunlight or being able to see in the dark better. • Light eyes can see better in the dark, dark eyes have less glare in the sun. • EX: Variation in skin color provides different benefits. • Skin color changes the overall affect of UV radiation due to melanin absorption. • Dark skin converts UV radiation into heat, light skin has higher frequency of skin cancer but can tan to accommodate extra sunlight. [The photochemical properties of melanin make it an excellent photoprotectant. It absorbs harmful UV-radiation and transforms the energy into harmless heat through a process called "ultrafast internal conversion".] This property enables melanin to dissipate more than 99.9% of the absorbed UV radiation as heat[3] • Where there’s more sunlight then the skin colors are generally, historically darker.

  35. The Benefits of Genetic Variability • Each version of the gene has advantages in some circumstances, disadvantages in others.

  36. What does this mean? • Having two parents that are genetically different creating a genetically different offspring allows for several ways to keep genetic diversity evolving, and this is a good thing. • 1st: New combinations from parents with different genes allow for new, maybe unseen traits to be created. • 2nd: Because we carry two copies of each gene, sometimes a trait that is bad right now will be kept in the gene pool, hidden by a more dominant form. Sometimes these traits turn out to be good later on down the road. • 3rd: If the environment suddenly changes, the estimate is 10% of the human population contains the trait necessary to survive almost any biologically significant event. • Viral or bacterial infection resistance. • Metabolic stress = lack of food/water. • Changes in O2 levels. • Changes in amounts of sunlight. • Temperature fluctuations.

  37. Karyotyping. • Today you will create and analyze a karyotype, one tool doctors & scientists use to determine ploidy number in an organism. • A karyotype can also be used as a pre-natal diagnostic tool to determine & predict abnormal births. • Review this assignment

More Related