1 / 27

National 5 Biology Unit 1 – Cell Biology

National 5 Biology Unit 1 – Cell Biology. Section 3 DNA and Production of Proteins. We will be learning…. How to describe the double helix structure of DNA How DNA carries the genetic information for making proteins

myother
Download Presentation

National 5 Biology Unit 1 – Cell Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. National 5 Biology Unit 1 – Cell Biology Section 3 DNA and Production of Proteins

  2. We will be learning… • How to describe the double helix structure of DNA • How DNA carries the genetic information for making proteins • How the complementary base pair sequence of adenine, thymine, guanine and cytosine determines the amino acid sequence in proteins. • That A is always paired with T and C is always paired with G • That a gene is a section of DNA which codes for a protein. • Messenger RNA (mRNA) is a molecule that carries a complementary code from the DNA in the nucleus to the ribosome. • Ribosomes are the site of protein synthesis where proteins are assembled from amino acids.

  3. What makes Organisms Different? Organisms differ because they have different genes. • Humans have human genes • Gerbils have gerbil genes • Bananas have (yes, you’ve guessed it) banana genes! Nobody else in the whole world has the same DNA as you!

  4. Genetic information The nucleus of living cells contain chromosomes which are made up of a sequence of genes.

  5. Inside the nucleus Inside the nucleus

  6. Chromosome Strand Cytosine Adenine Strand Guanine Thymine

  7. Chromosomes and their genes are made of a molecule called DNA DNA stands for deoxyribonucleic acid. The DNA molecule looks like a twisted ladder this spiral shape is called a DOUBLE HELIX Each chromosome is a very long molecule of tightly coiled DNA.

  8. DNA Bases The double helix ‘ladder’ of a DNA molecule is held together by ‘rungs’ made from pairs of chemicals called bases. Adenine There are four types of bases, and they are usually identified by their initials. Cytosine A C Guanine G Thymine T

  9. Base pairs hold the two strands of the DNA helix together. A A T T C C G G It is the sequence of these bases along a DNA molecule that forms an organisms genetic code.

  10. The ‘Rules’ Chargaff discovered that in any sample of DNA: Number of A = number of T Number of C = number of G

  11. The Genetic Code Every three bases in the DNA (codon) tells the cell which amino acid to use to help build proteins. T A T C G G T A C G T A DNA sequence Amino acids joined together in protein Alanine Glycine Proline Cysteine

  12. A T G C A C A T C A G T A C T T G G DNA and Proteins The sequence of bases on a DNA molecule determines the sequence of amino acids in a protein

  13. A A T G C A C A T C A G T C T T G G Coding for a Protein A different sequence of bases on a DNA molecule produces a different sequence of amino acids in a protein.

  14. Proteins Proteins are large molecules made by joining small subunits called amino acids together. There are 21 different amino acids. Different proteins have different combinations of the amino acids.

  15. Why do we need Proteins? • Enzymes are proteins that help us digest food. • Hair is protein. • Skin contains protein. • Antibodies which fight disease are proteins. • Our blood contains proteins.

  16. The chains of amino acid can then fold into different shapes which allow the proteins to do different jobs in the cell. Antibody Cell membrane pore Keratin (hair)

  17. DNA to Protein • The instructions for making protein have to pass from the nucleus to the ribosome a new molecule must be made…….. • Messenger RNA (mRNA) • Messenger RNA (mRNA) takes a copy of the code from DNA in the nucleus to the ribosome. • At the ribosome amino acids are assembled into a protein as directed by the code.

  18. DNA mRNA Protein The DNA sequence of the gene is copied. This copy is called messenger RNA (mRNA). The mRNA takes the copied instructions out of the nucleus and into the cytoplasm. In the cytoplasm, the mRNA is ‘read’ by a ribosome which uses the code to make the protein from amino acids.

  19. DNA  mRNA  Protein

  20. Can we make a Protein? Hint – Adenine pairs with Uracil on mRNA not Thymine • Use the following DNA strand to make the protein. You will need to convert the information into mRNA and then into Amino acids. CTAGAACCGTGTCGAAGTGTGGTG - DNA GAU CUU GGC ACA GCU UCA CAC CAC - mRNA Asp – Leu – Gly – Thr – Ala – Ser – His – His – Amino Acid

  21. Questions Put the statements below in the correct order, starting with D; A. DNA is made of bases B. Proteins form to substances like enzymes C. Amino acids join together D. Chromosomes are found in the nucleus of a cell. • Amino acids line up in order depending on the order of bases on DNA. F. Chromosomes are made of DNA. ____ ____ ____ ____ ____ ____ E B F D A C

  22. Questions • Where are genes located? • Where are chromosomes found? • What do genes contain the instructions for making? • Give 3 examples of proteins found in your body.

  23. Now I can….. • Describe the structure of the double helix • State that A pairs with T, and C pairs with G • State that a gene is a section of DNA that codes for a protein • Describe how the genetic code is translated from DNA to mRNA and then carried from the nucleus to the ribosome. • State that ribosomes are the site of protein synthesis

More Related