TACKLING OSTEOARTHRITIS -Research Tools At Our Disposal

1. TACKLING OSTEOARTHRITIS-Research Tools At Our Disposal Mahita Kadmiel July 21, 2005

2. OSTEOARTHRITIS • Arthritis -most common medical problem • No. 1 cause of disability in America. • arthron = joint itis = inflammation. arthritis = joint inflammation. • osteoarthritis, is the most common form of arthritis • affects nearly 21 million people in the United States

3. MENISCUSThe Meniscus: Shock Absorber for the Knee Meniscal Tears • Traumatic tears From a sudden load being applied to the meniscal tissue which is severe enough to cause the meniscal cartilage to fail and let go. Ex. Twisting injury • Degenerative meniscal tears Failure of the meniscus over time. The meniscus becomes less elastic and compliant May fail with only minimal trauma Ex. Just getting down into a squat *Degenerative meniscal tears can lead to osteoarthritis*

4. Healthy meniscus Torn meniscus

5. The expression of genetic material in the meniscus dictates it

6. Central Dogma of Life Reverse Transcription

7. Proteins make a cell what it is

8. Staining to find -how the cells look (anatomy) (TARA) • Staining to find • if cells are dead or alive (viability) • (TUMUL) TISSUE Histology CELLS Cell Biology TOOLS Proteins Molecular Biology Biochemistry Western Blotting -To detect proteins ELISA -To quantify proteins Enzyme Assays -To measure enzyme activity DNA Southern Blotting -To find copy number of genes Genome Sequencing Northern Blotting RT-PCR Real-Time PCR -To study gene expression RNA (TUMUL, BASIA & MYSELF)

9. Tools used in our lab RT-PCR Real-Time PCR -To study gene expression ELISA -To quantify proteins

10. Preparation of cDNA or first strand RT Reverse Transcription 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ mRNA 5’ GACCCAAUUGGUCAGCUAAAAAAA 3’ Reverse transcriptase ……TTTTTTT 5’ A, T, G, C dNTPs Reverse Transcription 3’ CTGGGTTAACCAGTCGATTTTTTT 5’ 1ST strand cDNA (complementary DNA)

11. PCR : Polymerase Chain Reaction

12. Reverse Transcriptase- Polymerase Chain Reaction -Exponential amplification End of 35 cycles 236 = millions of copies PCR products RT Marker RNA 22 23 24 32 copies 8 copies 4 copies 16 copies

13. Real-Time PCR SYBR Green Dye PCR products Single stranded DNA Double stranded PCR product SYBR Green fluoresces brightly only when bound to double stranded DNA Ethidium Bromide

14. Real-Time PCR • Quantitative method • Most reliable for mRNA (gene) expression • Small amounts of RNA required / tissue • Amplification monitored by fluorescence in real-time 96 well plate

15. Theoretical and Ideal Practical !!!!!

16. SERIES OF 10-FOLD DILUTIONS • Standard curve generated using serial dilution

17. Melting / Dissociation Curve primer dimer

18. E Enzyme Protein molecule that performs a chemical reaction L Linked Linking an enzyme to an assay/test Attachment of antibodies I Immuno S Sorbent Test to find out something A Assay • Technique based on antigen-antibody reaction • Examples: HIV tests &PGE2

19. Well with antibodies and BSA added Well with antibodies Well with antibodies, BSA, and test sample Well in a microtiter plate Antibody structure Well after washes with wash buffer ELISA Well after adding substrate Color developed due to the formation of a substrate Secondary antibody linked to an enzynme is added to the well Well after removing excess antibody

20. Other Techniques • Genome Sequencing • To find out • the base composition (A, T, G, C) • The order in which the bases are arranged • Northern Blotting ( mRNA expression) • Southern Blotting (copy number) • Western Blotting ( protein expression)

21. Southern / Northern Blotting

22. Western Blotting

23. IL-1 iNOS COX-2 MMP IL-1 TNF RT-PCR PGE2 iNOS iNOS ELISA Colorimetric Assays GAG Nitrate & Nitrite NO MMP COX-2 PGE2 (GAG) Degrades tissue Inflammatory mediators

24. Questions???????