1 / 12

Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay

Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay. Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon. Laboratories of America. Z. Why Impedimetric Detection?. Functionalized sensor – prior to analysis. Target analyte species bind to sensor

radley
Download Presentation

Impedance Sensor Arrays for Real Time and Label Free Bio-Affinity Assay

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Impedance Sensor Arraysfor Real Time and Label Free Bio-Affinity Assay Vena Haynes Mariya Smit & Andrei Ghindilis Holly M. Simon Laboratories of America

  2. Z Why Impedimetric Detection? Functionalized sensor – prior to analysis Target analyte species bind to sensor – impedance changes in real time Analyte injection • Advantages: • Label-free, real-time and rapid detection; • Inexpensive devices; • Local company (Camas, WA).

  3. Project Aims: #1 SH (thiol) Sensor array with reaction chamber attached New v3.0 sensor array format to test Sensor array surface functionalization • New SLA READER • Measures 15 channels • simultaneously • Eight impedance • measurements • per second per channel. • Sensor temperature • control. DNA oligonucleotide Au Au Ready for nucleic acid assay

  4. Project Aims: #2 Development of genomic assays • Detection of all E. coli strains using probes for a housekeeping gene adenylate kinase (ADK); • Detection of enteropathogenic E. coli isolates using virulence genes, hemolysin A (HlyA), and shiga toxin 2 (Stx2). E. coli strains • common commensal (laboratory K12) MG1655: adk gene only; • uropathogenic clinical isolate CFT073: adk and hlyA genes; • enterohemorrhagic (O157:H7, food poisoning) EDL 933: adk and stx2b genes.

  5. Project Aims: #2 Template E. coli genomic DNA PCR Amplicon Probe binding part Probes: Array functionalization ADK probe: TGGAGAAATATGGTATTCCG HlyA probe: TGAATTCCAGAAGCAAGTCT Stx2b probe: GCGGTTTTATTTGCATTAGT Target preparation: 1 Primer 2 Primer

  6. hlyA targets ds ss 500 400 300 200 75 Target preparation in detail: Target types: Single-stranded (ssDNA) Double-stranded (dsDNA) PCR amplicon PCR amplicon 95oC for 5 min l exonuclease digestion extra purification Simple and fast Standard, more sensitive?

  7. dsDNA test: Assay development Goals: to optimize conditions and to compare to the ssDNA test in terms of sensitivity (detection limit), specificity, and dynamic range. Assay parameters: tested selected Target concentration 2.5 and 0.5 µg/ml 0.5 µg/ml Buffer (SSPE) concentration 1x, 2x, 4x 2x Voltage (excitation potential) 40, 75, 100, 150 mV 75 mV Temperature 47, 52oC 52 oC?? For almost ALL tests Stx negative control demonstrated negligible signal. Hly negative control response minimization was the major challenge for assay optimization.

  8. Parallel Injection of Targets = ADK; specific = HlyA; neg. = Stx2; control Baseline Sample injection

  9. Sequential injection of targets to the same sensor arrays: HlyA buffer Hly ADK

  10. Sequential injection results: Stx2 buffer Stx ADK

  11. Conclusions • dsDNA target preparation • Optimized conditions • Demonstrated specific detection using ADK-functionalized sensor arrays • Still to do: Compare ssDNA and dsDNA targets

  12. Acknowledgements • Mariya Smit • Andrei Ghindilis • Holly Simon • Chris Brow • Simon/Haygood/Tebo Labs • Vanessa Green • CMOP • SLA: Kevin & Carmen • NSF

More Related