1 / 79

The human genome of is found where in the human body?

The human genome of is found where in the human body?. Nucleus Ribosome Smooth ER Cell membrane. The cellular structure where proteins are made is called the. Nucleus Smooth ER Ribosome Cell membrane. DNA and Biotechnology. Announcements. Ch 21- today Ch 21, 17- Wednesday

rhett
Download Presentation

The human genome of is found where in the human body?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The human genome of is found where in the human body? • Nucleus • Ribosome • Smooth ER • Cell membrane

  2. The cellular structure where proteins are made is called the • Nucleus • Smooth ER • Ribosome • Cell membrane

  3. DNA and Biotechnology

  4. Announcements • Ch 21- today • Ch 21, 17- Wednesday • Bone & muscle labs- Due Wednesday • Ch 21, 17 online quizzes- Due Friday • Quiz 10- Friday (chs 21, 17) • Lab today- pGLO (DNA transformation)

  5. Lecture Outline • DNA- Structure, function, and importance • How DNA works • The central dogma • Transcription and Translation • The DNA code • DNA replication

  6. The importance of DNA

  7. The DNA double helix is the code of life • The blueprint for all structures in your body which are made of protein • DNA is comprised of nucleotides

  8. Nulceotides are the monomers of nucleic acid polymers • Consist of a sugar, a phosphate, and a nitrogen-containing base • Sugar can be deoxygenated • Bases contain the genetic information

  9. There are 4 kinds of DNA bases

  10. Adenine always matches with Thymine, Cytosine always matches with Guanine-Hydrogen bonds hold bases together

  11. Cellular machinery is sophisticated and required for life Cellular machinery is made largely of proteins Blueprints for all cellular machinery are contained in genes Genes are inherited from parents Humans have ~30,000 genes Living things are extremely complex

  12. Proteins give living things the variety of their structures

  13. Protein variety is generated by 1o structure- the sequence of amino acids which make the protein

  14. Amino Acids • Proteins consist of subunits called amino acids Figure 2.12

  15. How DNA works • Replication • Transcription • Translation

  16. The sequence of DNA bases is the code for the primary structure of proteins

  17. All cells require a copy of the genome • Genome- all the genes of the cell • Human genome is made of DNA • DNA is similar in all cells • Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein) • DNA replication copies all cellular DNA

  18. Replication of DNA Figure 21.2

  19. In vivo, enzymes such as DNA polymerase make DNA replication happen

  20. The DNA code

  21. Computers use binary digital code • 01100001 = A • 01100010 =B • 01000011 =c • 00100111 = apostrophe • Etc. • http://www.geek-notes.com/tools/17/text-to-binary-translator/ 01000011 01101000 01100101 01100101 01110011 01100101 01100010 01110101 01110010 01100111 01100101 01110010 00100000 01000100 01100101 01101100 01110101 01111000 01100101 = cheeseburger deluxe

  22. How does the DNA code work? • atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttc=GFP

  23. The DNA code is (nearly) universal It uses groups of 3 bases (codon) 3 bases = 1 codon = 1 amino acid

  24. And what are these U’s for?

  25. RNA is ribonucleic acid • Ribose sugar is not deoxygenated • RNA is single-stranded • RNA has Uracil, not Thymine • There are many kinds: mRNA, rRNA, tRNA, siRNA, etc.

  26. RNA can fold back on itself • Single strand offers greater flexibility

  27. Kinds of RNA mRNA tRNA

  28. The Central Dogma of Molecular Biology • DNA RNA Protein • DNARNA : Transcription • RNA Protein: Translation

  29. When one DNA molecule is copied to make two DNA molecules, the new DNA contains •  A) 25% of the parent DNA.   • B) 50% of the parent DNA.   • C) 75% of the parent DNA.   • D) 100% of the parent DNA.   • E) none of the parent DNA.

  30. DNA RNA Protein Trait

  31. The Universality of the DNA code makes this possible Firefly gene (Luciferase) in a tobacco plant

  32. Transcription and Translation

  33. Transcription: DNA RNA

  34. DNA Codes for RNA, Which Codes for Protein Figure 21.3

  35. DNA information is transcribed into mRNA Note in DNA: sense strand vs. antisense strand

  36. Translation: RNA Protein

  37. tRNA’s carry an amino acid at one end, and have an anticodon at the other Amino acid attachment site: Binds to a specific amino acid. Amino acid (phenylalanine) Anticodon: Binds to codon on mRNA, following complementary base-pairing rules. Anticodon mRNA Figure 21.6

  38. The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence

  39. tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete

  40. We would expect that a 15-nucleotide mRNA sequence will direct the production of a polypeptide that consists of • A) 2 amino acids.   • B) 3 amino acids.   • C) 5 amino acids.   • D) 7 amino acids.   • E) 15 amino acids.  

  41. Viruses exploit the universality of the DNA code to take control of cells Basic life cycle of Viruses • Viruses are obligate intracellular parasites • They inject their genetic material into their host • Host machinery is commandeered to mass-produce virus • Viruses burst host cell to infect other cells

  42. Virus Structure • Many viruses contain only: • Protein capsid • Genome (DNA or RNA) • Some viruses have a phosopholipid bilayer envelope

  43. Bacteria are infected by viruses, too Bacteriophages attacking bacterial cell The lytic bacterial life cycle

  44. Bacteriophages • Infect bacteria • Cause formation of plaques on a lawn of agar in bacteria

  45. Bacteria use restriction enzymes to defend against viral DNA

  46. Restriction enzymes cut very specific sequences of DNA • Hundreds of different restriction enzymes have been found • Named after bacteria in which they are found

  47. Viruses such as T4 fight back with DNA ligase • Ligase glues DNA back together • Viral countermeasures against bacterial cell defenses

  48. Scientists commandeer these enzymes to perform DNA manipulations • Ligase and restriction enzymes allow any sequence of DNA to be cut and pasted at will • Plasmids, small loops of bacterial DNA, can be modified with any DNA • Because the genetic code is universal, DNA will be read in the same way

More Related