1 / 64

The Genetic Material

DNA. The Genetic Material. The Genetic Material. Sections. DNA Structure DNA Replication DNA Transcription DNA Translation Mutations Gene Expression. DNA is a BIG , intricately packaged molecule. What is DNA?.

rsherwin
Download Presentation

The Genetic Material

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA The Genetic Material The Genetic Material

  2. Sections • DNA Structure • DNA Replication • DNA Transcription • DNA Translation • Mutations • Gene Expression

  3. DNA is a BIG, intricately packaged molecule.

  4. What is DNA? DNA is the double stranded, helical nucleic acid that stores hereditary information.

  5. What is the Structure of DNA?

  6. What are “Nucleotides?” • The subunits within DNA which are attached to the ribose/phosphate “backbone.”

  7. DNA Structure

  8. Chromosome Structure

  9. Histone

  10. Chromosome number • All Species have a specific number of • chromosomes. ( Humans have 46) • Humans and animals have 2 types. • Sex chromosomes- determine • sex of the animal. (Humans • have X and Y - XX female • XY male.) • Autosomes- All other chromosomes

  11. DNA Structure

  12. Bonding in DNA…

  13. Model Key • Adenine (J) • Thymine (E) • Cytosine (G) • Guanine (F) • Deoxyribose sugar (A) • Phosphate (C) • ATTGATGCGCAC

  14. BUILD THIS! ATTGATGCGCAC

  15. DNA Replication • A single strand of DNA serves as a template for a new strand. • The rules of base pairing directreplication. • Each body cell gets acomplete set ofidentical DNA.

  16. Replication is a 3 Step Process • Step 1: The two Original DNA strands separate with help from “DNA Helicase” enzymes which “unzip” the helix.

  17. A 3 Step process… • Step 2: “DNA Polymerase” enzymes recognize specific “Origins of replication” sequences and begin adding complementary nucleotides to each strand.

  18. The “Magic” of “DNA Polymerase”…

  19. The Final Step • Step 3: Two identical DNA molecules are finally formed from the original and the enzymes detach.

  20. Errors in Replication… • Nearly 50 different enzymes play a role in ensuring that bases are not misplaced or mismatched in the replication process, thus limiting genetic mutations. • DNA Polymerase will not replicate a “mismatched Nucleotide” thus limiting genetic mutations.

  21. Multiple Replication Forks • Because chromosomes are so large, (billions of base pairs) multiple “replication forks” or bubbles work simultaneously to facilitate replication in about 9 hours.

  22. The Central Dogma:DNA Transcription and Translation ?

  23. Key Question: How do cells go from a master “blueprint” (the genetic code) to specialized proteins?

  24. The Central Dogma Transcription Translation

  25. Transcription: Step 1 Tightly packaged DNA must be unraveled and unwound by helicase enzymes inside the cell nucleus.

  26. Transcription: Step 1 (cont.) Helicaseenzymes are highly intricate and specialized in different types of cells. They are designed to recognize and unwind only certain sections of DNA in various cells depending on what proteins need to be constructed in that particular cell.

  27. For example: Cells at the base of a hair follicle transcribe and translate genes coding for the production of a protein called “Keratin.”

  28. Transcription: Step 2 RNA forms base pairs with DNA C pairs with G A pairs with U A complex of RNA polymerase enzymes recognize portions of the DNA that will be ‘copied.’ A single stranded copy is made called an mRNA transcript.

  29. mRNA vs DNA: Key Differences DNA Double stranded Deoxyribose sugar Bases: C,G, A,T mRNA Single stranded Ribose sugar Bases: C,G,A,U

  30. DNA Transcription

  31. DNA Transcription

  32. Transcription Challenge!Create an mRNA transcript for the following DNA sequence. ACGATACCCTGACGAGCGTTA UGC UAU GGG ACU GCU CGC AAU Hmmmm…

  33. Transcription: Step 3 After it is initially copied, the mRNA transcript is not yet complete. ‘Splicing’ enzymes recognize coding regions (exons) and non-coding regions (introns). Introns must be removed before the completed transcript can leave nucleus.

  34. Transcription Animation

  35. Transcription is Complete…What’s Next? How is mRNA “read” to generate proteins from Amino Acids? The mature mRNA transcript exits the nucleus through a nuclear pore. Once in the cytoplasm, it seeks out a ribosome to begin Translation.

  36. Ribosomes Ribosomes are referred to as rRNA and act as the site for translation. Composed of 2 subunits (large and small), separate in cytoplasm until they ‘clamp down’ on an mRNA transcript. Large subunit contains 3 binding sites called E, P, and A, respectively.

  37. tRNA- ‘The Essential Link’ Transfer RNA ‘delivers’ the proper amino acid to the ribosome by ‘reading’ the mRNA transcript in sets of 3 bases called “codons”. Bound to one of 20 different amino acids on one end On the other end Anticodon complements mRNA codon

  38. The Key to the Code:Which codons code for which amino acids?

  39. Translation: Initiation fMet P A Large subunit E UAC 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Small subunit Can you finish labeling this diagram by finding the: tRNA molecule amino acid codon anti-codon

  40. Translation Initiation Animation

  41. Translation - Elongation Polypeptide Arg Met Phe Leu Ser Aminoacyl tRNA Gly P A UCU Ribosome E CCA 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA

  42. Translation – Elongation (cont.) Polypeptide Met Phe Leu Ser Arg Gly P A Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA What portion of this complex will eventually become a ‘baby’ protein? tRNA

  43. Translation Elongation Animation

  44. Translation: Termination When a tRNA recognizes one of 3 “STOP” codons (see key), proteins called release factors cause the ribosome, the mRNA, and the new polypeptide to disassociate. The new polypeptide is complete. Note the untranslated region beyond the STOP codon.

More Related