'Ecori site' presentation slideshows

Ecori site - PowerPoint PPT Presentation

The if statement and files

The if statement and files

The if statement and files. The if statement. Do a code block only when something is True. if test: print "The expression is true". Example. if "GAATTC" in "ATCTGGAATTCATCG": print "EcoRI site is present". if the test is true. if "GAATTC" in "ATCTGGAATTCATCG" :

★ ★ ★ ★ ★

422 views • 35 slides
The if statement and files

The if statement and files

The if statement and files. The if statement. Do a code block only when something is True. if test: print "The expression is true". Example. if "GAATTC" in "ATCTGGAATTCATCG": print "EcoRI site is present". if the test is true. if "GAATTC" in "ATCTGGAATTCATCG" :

★ ★ ★ ★ ★

358 views • 35 slides
Analysis

Analysis

Analysis. www.le.ac.uk/genie. Full length. one site / one cut. Plasmid. A. A. two sites / two cuts. A + B = Full length. B. Plasmid. B. X. Z + Y. X. +. Y. Z + X. Plasmid. +. Y. Z. X + Y. Z . +. Restriction enzyme mapping. large. small. M. Restriction enzyme mapping.

★ ★ ★ ★ ★

383 views • 23 slides
Finding substrings

Finding substrings

Finding substrings. my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }. Finding substrings. my $sequence = " gatgcaggctcgctagcggct"; #Does this string contain a startcodon ?

★ ★ ★ ★ ★

292 views • 21 slides
Statistics in Bioinformatics

Statistics in Bioinformatics

Statistics in Bioinformatics. May 12, 2005 Quiz 3-on May 12 Learning objectives-Understand equally likely outcomes, counting techniques (Example, genetic code, PCR primer), E value Homework 10-due May 14, 2005. Statistical analysis of results underlies bioinformatics.

★ ★ ★ ★ ★

666 views • 12 slides

View Ecori site PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Ecori site PowerPoint presentations. You can view or download Ecori site presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.