'Longest common subsequence problem' presentation slideshows

Topic 1 Outline

Searching for Similarity in Sequences Gary Benson Departments of Computer Science and Biology Boston University. Topic 1 Outline. Similarity and Alignment Define homology, similarity by descent and similarity by convergence Common mutations and their mathematical models Alignments

2.03k views • 184 slides

The Longest Common Subsequence Problem and Its Variants

The Longest Common Subsequence Problem and Its Variants. ??? ?????????? http://www.nsysu.edu.tw. Outline. Introduction to Bioinformatics Traditional LCS Algorithms Our Works Block Edit Problems LCS of Run-Length Encoded Strings Merged LCS Problem Mosaic LCS Problem Conclusions.

1.25k views • 98 slides

Dynamic Programming: Edit Distance

Dynamic Programming: Edit Distance. Outline. DNA Sequence Comparison: First Success Stories Change Problem Manhattan Tourist Problem Longest Paths in Graphs Sequence Alignment Edit Distance Longest Common Subsequence Problem Dot Matrices. DNA Sequence Comparison: First Success Story .

1.29k views • 85 slides

Virdi Sabegh Singh (Advisor Dr. Robert A. Walker) Computer Science Department

Longest Common Subsequence Algorithm on ASC Processors using Coterie Network. Virdi Sabegh Singh (Advisor Dr. Robert A. Walker) Computer Science Department Kent State University. Presentation Outline. String matching and its variations Motivation of LCS

799 views • 69 slides

Virdi Sabegh Singh (Advisor Dr. Robert A. Walker) Computer Science Department

Longest Common Subsequence Algorithm on ASC Processors using Coterie Network. Virdi Sabegh Singh (Advisor Dr. Robert A. Walker) Computer Science Department Kent State University. Presentation Outline. String matching and its variations Motivation of LCS

790 views • 68 slides

Longest Common Subsequence

Longest Common Subsequence. Strand of DNA: a string of molecules called bases Four possible bases: adenine (A), guanine (G), cytosine (C) and thymine (T) DNA strand expressible as string over alphabet {A,C,G,T} Examples organism 1: ACCGGTCGAGTGCGCGGAAGCCGGCCGAA

870 views • 39 slides

Pairwise Sequence Alignment (I)

Pairwise Sequence Alignment (I). (Lecture for CS498-CXZ Algorithms in Bioinformatics) Sept. 22, 2005 ChengXiang Zhai Department of Computer Science University of Illinois, Urbana-Champaign. Many slides are taken/adapted from http://www.bioalgorithms.info/slides.htm.

420 views • 31 slides

Dynamic Programming

Dynamic Programming. Optimization Problems Dynamic Programming Paradigm Example: Matrix multiplication Principle of Optimality Exercise: Trading post problem. Optimization Problems. In an optimization problem, there are typically many feasible solutions for any input instance I

419 views • 30 slides

UMass Lowell Computer Science 91.503 Analysis of Algorithms Prof. Giampiero Pecelli Fall, 2010

UMass Lowell Computer Science 91.503 Analysis of Algorithms Prof. Giampiero Pecelli Fall, 2010. Paradigms for Optimization Problems Dynamic Programming & Greedy Algorithms. Optimization.

434 views • 29 slides

A Note on Useful Algorithmic Strategies

A Note on Useful Algorithmic Strategies. Kun-Mao Chao ( ??? ) Department of Computer Science and Information Engineering National Taiwan University, Taiwan WWW: http://www.csie.ntu.edu.tw/~kmchao. Greedy Algorithm. A greedy method always makes a locally optimal (greedy) choice.

361 views • 29 slides

A Note on Useful Algorithmic Strategies

A Note on Useful Algorithmic Strategies. Kun-Mao Chao ( ??? ) Department of Computer Science and Information Engineering National Taiwan University, Taiwan WWW: http://www.csie.ntu.edu.tw/~kmchao. Greedy Algorithm. A greedy method always makes a locally optimal (greedy) choice.

368 views • 29 slides

CHAPTER 2

382 views • 21 slides

CSIS-385: Analysis of Algorithms

322 views • 19 slides

An almost linear time and linear space algorithm for the longest common subsequence problem

213 views • 9 slides