'Splice acceptor' presentation slideshows

Gene Finding Approaches

Gene Finding Approaches. L529 Presentation (Nov 17, 2003) Xin Hong , Yi Zou and Xiang Zhou. Outline. Part I Overview of gene finding approaches Part II GENSCAN Part III TWINSCAN and GLASS-ROSETTA Part IV Evolutionary Hidden Markov Model. Introduction.

1.21k views • 69 slides

Basic Molecular Biology

451 views • 33 slides

Nicole Motton Birmingham RCPath Self-help Course

1. Define, with examples, the following: a) Exon Splicing Enhancer b) Nonsense Mediated Decay c) Cryptic Splice Site How would you investigate the effect of a potential splicing mutation?. Nicole Motton Birmingham RCPath Self-help Course

459 views • 30 slides

Structure of MMP-iresGFPneo

Structure of MMP-iresGFPneo. Genome length 4294 nt, without transgene Capacity ~4,100 bp. LTR. LTR. Y. Transgene. Provirus. GFP. neo. IRES. SD. SA. Y. Transgene. m7 G-. -A n. RNA Genome. GFP. neo. IRES. SD. SA. Transgene. Spliced Message. m7 G-. -A n. GFP. neo. IRES.

150 views • 1 slides

Structure of SFG-TRE-ECT3-

Structure of SFG-TRE-ECT3-. Genome length 1725nt, without transgene Capacity ~6,200 bp. (By special request only.). D U3 LTR. LTR. Y. MCS. Provirus. 7 tetO. SD. SA. Y. MCS. m7 G-. -A n. RNA Genome. 7 tetO. SD. SA. MCS. m7 G-. -A n. Spliced Message. 7 tetO.

134 views • 1 slides

(i) Minus-strand priming site

a. Replication. (i) Minus-strand priming site. (ii) Plus-strand primer. 4321 CGCCCGCCATTATTTTCAAACATTCCTGAAA 4329 ............................... 4327 ............................... 4329 .AAAGA..CC................A. Ph Ch Se SA. 1 TGGTATCAGAGCGATGTT 1 ..................

83 views • 1 slides