430 likes | 541 Views
From Bugs to Barcodes: Using Molecular Tools to Study Biodiversity . Mandy Butler, Heather Henter, Stephanie Mel University of California, San Diego. Biodiversity. Biodiversity knowledge gap. How can we conserve what we don’t know we have?. How can we address the biodiversity knowledge gap?.
E N D
From Bugs to Barcodes: Using Molecular Tools to Study Biodiversity Mandy Butler, Heather Henter, Stephanie Mel University of California, San Diego
BARCODING DNA BARCODE specific region in an organism's DNA as a genetic marker to identify species How? compare DNA sequence with sequences in a public reference library (GenBank or BOLD)
Optional Optional
Why is barcoding useful? Anyone that can do PCR and pay for sequencing can generate barcode data Morphological identification difficult for non-specialist
Student collaboration ecology courses molecular biology courses Also, independent study students
Invertebrate Animals Scale=5 mm
Hypothesis testing vs. Discovery science Questions we have addressed: What is the frequency of Africanized honey bees in our area? (63%) Is there zonation in species distribution of bloodworms in our intertidal? (no) Do flower-inhabiting thrips (Thysanoptera) specialize on different species of plant host? ____________________________________ What species inhabit the sandy beach? What spiders species are at our reserve?
BARCODING WORKSHOP Morning: 1. Collect organisms Afternoon: 2. Extract DNA 3. PCR 4. prepare DNA to be sent out for sequencing 5. bioinformatics with previous sequences
Today’s insect collecting Each group: insect net aspirator & aspirator vials 2 mL vials with 70% ethanol blank labels white paper plate fine paint brush sharp pencil kill jar
History of Barcoding http://www.dnabarcoding101.org/
Future DNA search engine: 1 minute, 1 sequence, 1 name, 1 penny. Radio Shack, barcorder$2.99
iBOL: create a searchable directory for life on earth. And to build it, 7 billion searchers.
Introduction http://www.dnabarcoding101.org/dna_barcoding_ani.html
Barcoding protocol Insect collection DNA extraction Amplification of COI gene by PCR Direct sequencing of cleaned up PCR product Analysis of sequence
DNA EXTRACTION • Remove leg if large insect • Grind up entire insect if very small • Follow extraction protocol
Small ribosomal RNA The Mitochondrial Genome D-Loop mtDNA DNA Cytochrome b ND1 ND6 ND5 COI ND2 COI L-strand H-strand Typical Animal Cell ND4 ND4L COII ND3 COIII ATPase subunit 8 ATPase subunit 6 Mitochondrion An Internal ID System for All Animals Slide from David E. Schindel
DNA from your organism Selectively Amplify CO1 DNA (make millions of copies)
PCR - Polymerase Chain Reaction 5’ 3’ CO1 DNA 3’ 5’ 30+ cycles of amplification PCR product: Billions of copies of CO1 DNA sequence from your organism of interest
Cut band out of gel with razor blade Follow clean-up protocol
Cleaned up CO1 PCR product from organism of interest
Barcoding protocol Insect collection DNA extraction Amplification of COI gene by PCR Direct sequencing of cleaned up PCR product Analysis of sequence
WHAT IS THE CO1 DNA SEQUENCE FROM MY ORGANISM OF INTEREST?
Compare CO1 sequences from different organisms Org 1 - CTGCTGACATCGATGCTGATCGGAGTATCATAA Org 2 - CTGCTGACATCGATGCTGATCGGACTATCATAA Org 3 - CTGCTGACATTGATGCTGATCGGACTATCATAA Org 4 - CTGCTGACATTGATGCTGATCGGACTATCATAA Org 5 - CTGCTGACATCGATGCTGATCGGACTATCATAA
Discover a new species! Ask exciting scientific questions! Brooklyn vs. Bronx Bedbugs What lives in the subway? Expose a local restaurant! Publish!
Why is a mitochondrial gene used for barcoding? Review of Mitochondrial DNA • Circular DNA, 17000 bp • Hundreds of copies per cell • Inherited from mother only – so haploid • No recombination • Contains 37 genes – no introns • 22 tRNAs • 2 rRNAs • 13 genes involved in cellular respiration http://www.geneticorigins.org/mito/intro.html
The CO1 gene is the standard gene for barcoding in animals • The cytochrome C oxidase (CO1) gene has been designated the standard gene for barcoding of animals • It is a protein coding gene of about 1500 bp with no introns • The COI region that is used for barcoding includes the first half of the gene and is approximately 650 basepairs long • PCR is used to amplify this region; the PCR product is then sent for sequencing
1. Mitochondrial genes are haploid • In doing barcoding, we want to make the sequencing part as easy as possible – we want to be able to isolate DNA, amplify it and sequence it without having to clone the DNA • Thus it is important to use a haploid gene as our identifying gene. (If you used a diploid gene, you would get product with possible 2 different sequences.) • So we can’t use nuclear genes – instead we use a mitochondrial gene for animal barcoding
2. Mitochondrial genes are present in high copy numbers in cells
3. Mitochondrial genes exhibit more differences in sequence among species than nuclear genes, and less difference within species • Sequence differences among closely related animal species average 5- to 10-fold higher in mitochondrial than nuclear genes. • Intraspecific variation in mitochondrial DNA is low in most animal species. • Thus small intraspecific and large interspecific differences make distinguishing genetic boundaries between species easier, enabling more precise identification.
Universal primers • “Universal primers” are primers that are designed to areas in genes that are highly conserved among different species. • Thus universal primers are not species specific • This means that the primers are probably not totally complementary to the sequence in your insect sample but they are similar enough to hybridize at a low annealing temperature sample • The sequence in the CO1 gene in between where the primers hybridize is less well conserved and thus can be used to differentiate members of different species.
PCR conditions • Since we do the annealing step at 42 C, we do often get non-specific products • We run a gel to see if the PCR worked, and then clean up the PCR sequence to send for sequencing. Because we may have extra bands, we will gel purify the band of the expected size, which is 658 basepairs • Sequencing will be done using the forward primer • We will then analyze the sequences and use Blast to try determine the genus and species of your samples
Bioinformatics • First we determine if the sequence for the insect is in Genbank by doing a Blast • We will consider any hit with an identity of 97% or better the same species. • If the match is less than 97%, it means the barcode sequence for theinsect is not in Genbank
Intraspecies genetic diversity • Once we have a set of sequences from the same organisms (i.e., same genus and species) we will also look at genetic diversity within that organism (SNPs)