Genetic Diagnosis in Niemann-Pick Type C disease

1. Genetic Diagnosis in Niemann-Pick Type C disease Chris Bruce, Chris Hendriksz, Paul Gissen,

2. Plan of the talk Genetics of Niemann-Pick Type C disease Current diagnostic paradigms Is there a need for rapid genetic diagnosis in NPC Brum chip Genetic testing

3. Genetics of NPC Autosomal recessive inheritance Mutations in either of the 2 genes: NPC1 and NPC2 NPC1-large membrane protein NPC2-small soluble protein Suggestions of genotype-phenotype correlation Approximately 300 reported mutations

4. Why is it important to detect mutations in NPC disease? • Accurate and quick diagnosis • Potential for recognising correlation between mutations and disease course • As new therapies are being developed, important to diagnose early: • Diagnosis and treatment prior to development of neurological symptoms • Screening of pre-symptomatic siblings • Carrier detection

5. Current state of diagnosis in NPC disease • Patients presents to our centre with typical features: • neonatal jaundice and large liver and spleen • Eye movement abnormalities and large spleen • Other neurological features • Chitotriosidase enzyme is measured as a possible marker of NPC • Bone marrow biopsy • Liver biopsy • Skin biopsy taken

6. Diagnosis of NPC • If chito/bone marrow/liver biopsy suggestive then: • Skin fibroblasts are grown • Sent for Filipin staining/cholesterol esterification studies • If the above studies are abnormal then mutation analysis is suggested • At least a limited mutation analysis is offered by three UK centres currently

7. Pitfalls Delay in presentation to the tertiary IMD centre leads to delay in diagnosis Initial markers (chito, BMBx) can appear normal Very significant delay until diagnosis with such a path Negative filipin staining has been reported in proven NPC cases No carrier screening is possible without identified mutations

8. Improvements in molecular genetic diagnosis London: full sequencing is available for NPC1 gene Manchester: stepwise sequencing of NPC1 and NPC2 Birmingham: full sequencing is available for NPC1 and NPC2 genes Rapid microarray-based gene sequencing in final stages of development

9. View of a clinician-scientist It takes too long to make a diagnosis Pitfalls at every step and some patients are not diagnosed correctly (our clinical examples) Potential availability of promising treatments makes early diagnosis more relevant New laboratory methods of molecular diagnosis may help

10. Three techniques can be used 1) Capillary Sequencing: current gold standard 2) Re-sequencing arrays: ??most efficient at present 3) Second generation sequencers: will be a success in the future

11. Capillary Sequencing TAGCCATCGGAACGTACTCAATGATGTCGA Gold standard method for detecting genetic mutations. Major limiting factor is size of DNA stretches that can be sequenced Generally DNA products are less than 500bp

12. Re-Sequencing Arrays (chips) ATCGGTAGCCTT CATGAGTTACTA G ||||||||||||||||||||||||| TAGCCATCGGAACGTACTCAATGATGTCGA Provide a way of sequencing large amounts of DNA quickly and easily. The size of the PCR (DNA amplification) products can be of any length. Sequences both forward and reverse strands simultaneously. One chip can hold huge amount of DNA: enough to cover 100 genes Have the ability to sequence 100 genes in a single experiment.

13. Microarray gene sequencing: is this the way to rapid genetic diagnosis? • Pros: • Detects mutations quicker than conventional sequencing by eliminating several steps • Can screen several genes for mutations at the same time • Can be much cheaper than conventional sequencing of several genes • Cons • will miss some new mutations (approx 5-10%) • Not much cheaper than conventional sequencing of one gene

14. The CHIP Metabolic Chip

15. When do we propose to use gene chip sequencing Rapid diagnosis is required Different diseases can cause almost identical clinical picture Specific treatments depends on the nature of the gene and the mutation

16. Proposed project: “Detecting genetic causes of liver disease in infants” Up to 10 genetic causes of infantile liver disease: present with jaundice and enlarged liver +/- spleen All genes are large and difficult to sequence Accurate diagnosis is not possible without gene sequencing 1-10 genes may need to be sequenced before diagnosis is reached Time course from presentation till accurate molecular diagnosis may be several years Approximately 10% are caused by NPC disease

17. Comparison of the work involved • Conventional method: • To sequence 10 jaundice genes (including NPC1 and NPC2) – approx 700 chemical reactions (PCR and sequencing) • Cost approx £500X10=£5000 (cheapest estimate) • With current system will require >1 year • Microarray: • 50 reactions • Cost approx £600 • If optimised, can be done within 2 weeks in one lab

18. Proposal Screen all infants presenting with liver disease to liver centres using a microarray sequencing chip for mutations in 10 genes simultaneously

19. How do DNA chips work A series of DNA stretches “probes” are attached to a glass slide. Each probe is 25 bases in length and is designed against a reference sequence (thanks to Human Genome Project) Each probe only tests one nucleotide, “central base”. Each central base tested 8 times.

20. Probes in use ATCGGTAGCCTT CATGAGTTACTA G ATCGGTAGCCTT CATGAGTTACTA A ||||||||||||||||||||||||| |||||||||||| |||||||||||| TAGCCATCGGAACGTACTCAATGATGTCGA TAGCCATCGGAACGTACTCAATGATGTCGA ATCGGTAGCCTT CATGAGTTACTA C ATCGGTAGCCTT CATGAGTTACTA T |||||||||||| |||||||||||| |||||||||||| |||||||||||| TAGCCATCGGAACGTACTCAATGATGTCGA TAGCCATCGGAACGTACTCAATGATGTCGA

21. Probe arrangement on the CHIP Uses fluorescence detection system 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 A G A G A G A G A G A G A G A G A G A G A G A G A G A G A G C T C T C T C T C T C T C T C T C T C T C T C T C T C T C T C G A G T T T T G C G A A T C

22. Scanning

23. The Birmingham Metabolic Disorder Re-Sequencing Chip BRUM CHIP contains 91genes encompassing 232512 base pairs of reference sequence DNA. Also tiled are known insertions and deletions which may not normally be picked up. A total of 1.8 million probes are present on the chip in an area of 4cm2.

24. Disease type coverage on the CHIP Lysosomal Storage Glycogen Storage disorders Cholestasis/ liver disease Neurodegeneration Endocrine Malignancy Growth Diabetes Obesity Lipid disorders

25. Data analysis Special computer programme A file is generated for each probe The initial testing showed extremely high degree of sensitivity, specificity and reliability for the tested genes Insertion/deletions may not be identified by this method unless specifically represented on the chip

26. Mutation Identification

27. Comparison of GSeq and Capillary sequencing G A G NPC1 exon 9 1553G>A GA

28. Summary of the work so far 18 genes have been optimised for microarray resequencing DNA samples with >100 different known mutations have been tested 95% of all mutations were detected first time 98% of single single nucleotide changes detected Quality of results is comparable to the conventional sequencing New heterozygous deletions/insertions NOT detected

29. Detection of novel mutations TAGCCATCGGAACGTAACGTACTCAATGATGTCGA WT TAGCCATCGGAACGTACTCAATGATGTCGA TAGCCATCGGACTCAATGATGTCGA Expect to detect all new mutations apart form heterozygous inertions/deletions Will detect all known mutations including insertions/deletions Most new homozygous insertions/deletions will be found Results can be generated within <2 weeks

30. Clinical scenarios: best DNA test • Rapid phenotype specific diagnostic screening: Microarray sequencing • Complete sequencing of NPC genes in a very likely NPC case: conventional sequencing • Carrier detection if the mutation is known: any test which screens just the one mutation • e.g. conventional sequencing of one DNA fragment known to contain the mutation • Or chip if the rest of the array is used for other purposes

31. Thank you • Questions ?? • Acknowledgements • UoB: Chris Bruce, Eamonn Maher, Tim Barrett • BCH: Chris Hendriksz, Deirdre Kelly • BWH: Fiona MacDonald • Arnold Reuser • RMCH: Lesley Heptinstall, Ed Wraith • KCH: Alex Knisely • All supporting clinicians • Birmingham Children’s Hospital Research Foundation • Children’s Liver Fund • Actelion, Ferring

32. Known NPC mutations • Majority and single nucleotide changes • 80/268 mutations are small insertions/deletions which are tiled separately • 4/268 are gross insertions or deletions which would not be detected by the chip but may be detected by PCR • In NPC2: 2/18 known mutations are small deletions/insertions which are tiled on the chip

33. Summary Chip sequencing can detect >95% of mutations Chip sequencing is particularly time and cost efficient when sequencing of several genes is required at the same time One chip can be used for several patients if they are tested for different diseases