1 / 68

Warm Up

Warm Up. Name as many of the types of inheritance you can remember from Friday. What are the different blood types a person can have?. Agenda. Objective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymine KWL Chart on DNA DNA Building Activity

vinnie
Download Presentation

Warm Up

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Warm Up • Name as many of the types of inheritance you can remember from Friday. • What are the different blood types a person can have?

  2. Agenda • Objective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymine • KWL Chart on DNA • DNA Building Activity • Notes on DNA • You will not always get a stamp if you simply finished the warm up. I will start checking for correct answers. • Testing

  3. Quizzes • If you did not take the quiz last week, you need to make it up in order to avoid earning a zero. • If you earned below a C on the quiz, you can come in to do a retake.

  4. KWL Chart

  5. What do we already know about DNA? • It stands for Deoxyribonucleic Acid • All living things have DNA • In Eukaryotic cells, DNA is found in the nucleus • It carries our genetic information and determines our traits • Segments of DNA are called genes • DNA is bundled up into chromosomes

  6. Why is DNA important? • DNA contains our genetic information • DNA is a set of instructions for making proteins • Proteins determine just about everything about you • Whether you are lactose intolerant • What skin color you have • Your eye color • Control the rate of reactions in our body

  7. DNA building activity

  8. Warm up Directions: Unless I tell you otherwise, you do not have to copy the questions anymore But you need to date every warm up and try to answer the questions correctly. Name at least two reasons why DNA is important. Write in complete sentences.

  9. Warm up • Write three observations about this picture. • Make an inference about what you think is happening.

  10. Agenda • Objectives: SWBAT Describe what happens during replication and use the base pairing rule to determine sequences of DNA. • Notes • Practice Problems • Cracking the Code Video

  11. What is the Structure of DNA? • Deoxyribonucleic Acid or DNA looks like a twisted ladder or double helix • It’s made up of subunits called nucleotides - Each nucleotide has a sugar, a phosphate and a nitrogen base

  12. Label the parts on your copy: Hydrogen Bonds Nitrogen Base Phosphate Sugar (Deoxyribose)

  13. Types of Nitrogen Bases • There are 4 types of nitrogen bases in DNA • A= Adenine • T= Thymine • C= Cytosine • G= Guanine • Nitrogen bases connect the 2 strands of DNA together, like the rungs (steps) of a ladder

  14. Base Pairing • Nitrogen bases pair up to make the steps of the ladder • In DNA - “A” always pairs with “T” And - “C” always pairs with “G”

  15. Complementary Strands • Each strand of DNA is complimentary to the other • That means that each strand’s nitrogen bases match up (A - T, C - G) • Example: If the code on one strand of DNA is ACGTC, then the complimentary strand would be TGCAG

  16. Practice Problems: Write the Complimentary Strand in your notebook 1. ATCGC 2. TGCAGA 3. CCCGTACGTA 4. TAGTGACTAGC 5. AAAGTAATGTTCAGTACTTT

  17. Before a cell divides, what does it need to do?

  18. DNA Replication Video

  19. Enzymes • Enzymes are responsible for unzipping the DNA and adding the bases to form the 2 molecules of DNA. • Enzymes are proteins in our cells. They help regulate chemical reactions in our body. • Helicasesare enzymes that split the DNA and DNA polymerase adds the bases • Proteins help make proteins!

  20. DNA- Cracking the Code • http://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html

  21. Warm up • What happens during Replication? • If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?

  22. What’s different about these two structures? (Name at least two differences) • What happens during Replication? • If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?

  23. What’s different about these two structures?

  24. Agenda • Objectives: SWBAT: compare and contrast DNA and RNA by creating a chart • Test Taking Strategies • Comparison Chart • Video Clip • Worksheet • Cracking the Code video

  25. RNA • RNA is another type of nucleic acid that’s found in the nucleus and cytoplasm of a cell • Unlike DNA, RNA is made up of only one strand of nucleotides

  26. Difference in Nitrogen Bases • Instead of having the base thymine, RNA has the base uracil • That means when RNA is formed, adenine pairs with uracil (A - U)

  27. Difference in Sugars • One main difference between RNA and DNA is that they are made up of different sugars - RNA has the sugar ribose - DNA has the sugar deoxyribose

  28. Different segments • DNA is split up into segments called genes • mRNA is split up into sections called codons. • Every three bases of mRNA = one codon. • Example: AUC or GGU • Codons code for amino acids that make up proteins

  29. Draw the following chart

  30. How are proteins made? • In order to make proteins, 3 processes must occur • DNA Replication • Molecule of DNA is copied • Transcription • Strand of mRNA is made using DNA as a template • Translation • mRNA codes for specific amino acids that make a protein

  31. Worksheet

  32. Warm Up

  33. Agenda • Objectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins. • Notes • Practice Worksheet • White Board Practice??

  34. Video

  35. What happens during Transcription? • A strand of messenger RNA (mRNA) is made using DNA as a template.

  36. What happens during Transcription? • One strand of the DNA is the template • Nitrogen bases attach to the DNA by following the base pairing rule except U will replace T • The sequence (order of the nitrogen bases) of RNA depends on the strand of DNA • Example: A-C-C-A-A-A U-G-G-U-U-U

  37. demo

  38. DNA- Cracking the Code • http://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html

  39. Practice Work Sheet

  40. White Board Practice

  41. What’s missing in this nucleotide? deoxyribose + phosphate + _________ ______

  42. What type of sugar does RNA have?

  43. “A” pairs with ____ “C” pairs with ____

  44. (DNA or RNA)_________ is made up of 2 strands of nucleotides.

  45. If the code of bases on one strand of DNA is AGCCTAGG, then what is the code on the complimentary strand?

  46. What is the process that makes a copy of DNA?

  47. In RNA, Thymine is replaced with ________

More Related