680 likes | 827 Views
Warm Up. Name as many of the types of inheritance you can remember from Friday. What are the different blood types a person can have?. Agenda. Objective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymine KWL Chart on DNA DNA Building Activity
E N D
Warm Up • Name as many of the types of inheritance you can remember from Friday. • What are the different blood types a person can have?
Agenda • Objective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymine • KWL Chart on DNA • DNA Building Activity • Notes on DNA • You will not always get a stamp if you simply finished the warm up. I will start checking for correct answers. • Testing
Quizzes • If you did not take the quiz last week, you need to make it up in order to avoid earning a zero. • If you earned below a C on the quiz, you can come in to do a retake.
What do we already know about DNA? • It stands for Deoxyribonucleic Acid • All living things have DNA • In Eukaryotic cells, DNA is found in the nucleus • It carries our genetic information and determines our traits • Segments of DNA are called genes • DNA is bundled up into chromosomes
Why is DNA important? • DNA contains our genetic information • DNA is a set of instructions for making proteins • Proteins determine just about everything about you • Whether you are lactose intolerant • What skin color you have • Your eye color • Control the rate of reactions in our body
Warm up Directions: Unless I tell you otherwise, you do not have to copy the questions anymore But you need to date every warm up and try to answer the questions correctly. Name at least two reasons why DNA is important. Write in complete sentences.
Warm up • Write three observations about this picture. • Make an inference about what you think is happening.
Agenda • Objectives: SWBAT Describe what happens during replication and use the base pairing rule to determine sequences of DNA. • Notes • Practice Problems • Cracking the Code Video
What is the Structure of DNA? • Deoxyribonucleic Acid or DNA looks like a twisted ladder or double helix • It’s made up of subunits called nucleotides - Each nucleotide has a sugar, a phosphate and a nitrogen base
Label the parts on your copy: Hydrogen Bonds Nitrogen Base Phosphate Sugar (Deoxyribose)
Types of Nitrogen Bases • There are 4 types of nitrogen bases in DNA • A= Adenine • T= Thymine • C= Cytosine • G= Guanine • Nitrogen bases connect the 2 strands of DNA together, like the rungs (steps) of a ladder
Base Pairing • Nitrogen bases pair up to make the steps of the ladder • In DNA - “A” always pairs with “T” And - “C” always pairs with “G”
Complementary Strands • Each strand of DNA is complimentary to the other • That means that each strand’s nitrogen bases match up (A - T, C - G) • Example: If the code on one strand of DNA is ACGTC, then the complimentary strand would be TGCAG
Practice Problems: Write the Complimentary Strand in your notebook 1. ATCGC 2. TGCAGA 3. CCCGTACGTA 4. TAGTGACTAGC 5. AAAGTAATGTTCAGTACTTT
Enzymes • Enzymes are responsible for unzipping the DNA and adding the bases to form the 2 molecules of DNA. • Enzymes are proteins in our cells. They help regulate chemical reactions in our body. • Helicasesare enzymes that split the DNA and DNA polymerase adds the bases • Proteins help make proteins!
DNA- Cracking the Code • http://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html
Warm up • What happens during Replication? • If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?
What’s different about these two structures? (Name at least two differences) • What happens during Replication? • If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?
Agenda • Objectives: SWBAT: compare and contrast DNA and RNA by creating a chart • Test Taking Strategies • Comparison Chart • Video Clip • Worksheet • Cracking the Code video
RNA • RNA is another type of nucleic acid that’s found in the nucleus and cytoplasm of a cell • Unlike DNA, RNA is made up of only one strand of nucleotides
Difference in Nitrogen Bases • Instead of having the base thymine, RNA has the base uracil • That means when RNA is formed, adenine pairs with uracil (A - U)
Difference in Sugars • One main difference between RNA and DNA is that they are made up of different sugars - RNA has the sugar ribose - DNA has the sugar deoxyribose
Different segments • DNA is split up into segments called genes • mRNA is split up into sections called codons. • Every three bases of mRNA = one codon. • Example: AUC or GGU • Codons code for amino acids that make up proteins
How are proteins made? • In order to make proteins, 3 processes must occur • DNA Replication • Molecule of DNA is copied • Transcription • Strand of mRNA is made using DNA as a template • Translation • mRNA codes for specific amino acids that make a protein
Agenda • Objectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins. • Notes • Practice Worksheet • White Board Practice??
What happens during Transcription? • A strand of messenger RNA (mRNA) is made using DNA as a template.
What happens during Transcription? • One strand of the DNA is the template • Nitrogen bases attach to the DNA by following the base pairing rule except U will replace T • The sequence (order of the nitrogen bases) of RNA depends on the strand of DNA • Example: A-C-C-A-A-A U-G-G-U-U-U
DNA- Cracking the Code • http://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html
What’s missing in this nucleotide? deoxyribose + phosphate + _________ ______
“A” pairs with ____ “C” pairs with ____
(DNA or RNA)_________ is made up of 2 strands of nucleotides.
If the code of bases on one strand of DNA is AGCCTAGG, then what is the code on the complimentary strand?