1 / 31

Marker asisted selection (MAS) in increasing production traits of Friesian

Marker asisted selection (MAS) in increasing production traits of Friesian Holstein dairy cattle in Indonesia. SUTARNO. Biology Department, Faculty of Mathematics and Natural Sciences,. Sebelas Maret University,. Jl. Ir. Sutami 36A Surakarta, 57126 Indonesia.

vivianr
Download Presentation

Marker asisted selection (MAS) in increasing production traits of Friesian

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Marker asisted selection (MAS) in increasing production traits of Friesian Holstein dairy cattle in Indonesia SUTARNO Biology Department, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Jl. Ir. Sutami 36A Surakarta, 57126 Indonesia

  2. Friesian Holstein Dairy Cattle • The first Indonesian FH cattle was imported from Australia, New Zealand and USA, and reared in Java highland at 700 m above sea level • Good performance in reproduction and milk production • Able to adapt with indonesian climate under temperatures range 5-250C

  3. Breeding Selection Selection is one of the effort to improve genetic potential in animal population DNA based (Marker assisted selection ) Conventional (phenotype)

  4. MOLEKULER MARKER Genetic marker Specific DNA variation among individual that associated with specific characters Marker-assisted Selection (MAS) an indirect selection process where a TRAIT of interest is selected based on a MARKER linked to a trait of interest rather than on the trait itself. Microsatellite simple sequence tandem repeats of di-, tri- tetra- or penta-nucleotides.

  5. Selection Selection to find the best cattle in the population. Selected cattle will be used in the future breeding, to get better progeny and increase performance in the next generation. Existing selection techniques still rely on laborious and time-consuming progeny testing programs and depend on subjective assessment of the phenotype.

  6. Marker-Assisted Selection • Recent developments in biotechnology have made possible to unravel a large number of genetic polymorphisms at the DNA level. • Marker-assisted selection (MAS) could be particularly profitable in dairy cattle. • Technique for rapid genetic selection by identifying genomic regions that control variation in quantitative traits • The development of MAS identification can prove that DNA testing can be applied simply to detect alleles variation

  7. Microsatellites • Microsatellite, a new class of genetic marker, is a technique based on length variation within tandem arrays of di-, tri-, or tetra nucleotide motifs. • There are several published paper tried associating microsatellite and quantitative performance trait in the dairy cattle population.

  8. Methods Cluster Retrieve Clustering using Venn Diagram to select microsatellite candidate which associated for reproduction trait Retrieving microsatellite associated with reproduction, milk production and body conformation trait from published paper Recommendation 16 recommended microsatellite candidate by International Society for Animal Genetics 1http://www.fao.org/docrep/meeting/021/j1998e.pdf 2http://www.thearkdb.org/arkdb/

  9. Microsatellite recommendation by FAO

  10. Results Microsatelites association Venn Diagram all trait Traits Total Microsatellite Body Conformation, Milk Production, Reproduction 5 BM1818, BM1824, ETH225, BM2113, ETH152 Body Conformation, Milk Production 1 ETH10 Body Conformation, Reproduction 1 INRA032 Milk Production 4 ETH3, HEL13, ETH185, HEL1 Reproduction 1 MM12

  11. •Performance affected by interaction between genetic and environment factors (P = G x E) • Genotype-based selection for intersted phenotype traits.

  12. Production/ performance traits of dairy cattle under study Reproduction Milk Production Body Conformation

  13. 1. Reproduction • Cows start producing milk after partus and will ongoing if the reproduction process continues. • Milk performance and reproductive parameters are very important in term of management and profitability. • Reproductive performance is probably the most important factor that is a prerequisite for sustainable dairy production system and influencing the productivity.

  14. Reproduction parameters postpartum mating (PPM) services per conception calving interval (CI) (SC)

  15. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) BM1824 Weller et al. (2008) BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  16. MICROSATELLITE DNA AMPLIFICATION • ETH225, Tm 57°C, 131 – 159 bp • ETH152, Tm 61°C, 181 – 211 bp Primer forward 5’-TACTCGTAGGGCAGGCTGCCTG-3’ Primer reverse 5’-GAGACCTCAGGGTTGGTGATCAG-3’ Primer forward 5’-GATCACCTTGCCACTATTTCCT-3’ Primer reverse 5’-ACATGACAGCCAGCTGCTACT-3’ Pre- Denaturation 95°C Final extension 72°C Storage denaturation 4°C 95°C Annealing 55°C Extension 72°C (30 detik) (5 menit) (10 menit) • The product of DNA amplification visualized in Polyacrylamide Electrophoresis Gel (PAGE)

  17. An example of Allel variation (genotyping) using ETH225 PAGE •POLYACRYLAMIDE GEL 12% •Variasi genotip, masing-masing 8 variasi •ETH225 AA, AC, AD, BC, BD, BE, CE, DE

  18. ETH225 (189 bp) • (TG)4(CG)(TG)(CA)18 GATCACCTTGCCACTATTTCCTCCAACATATGTGTGTGCGTGCA CACACACACACACACACACACACACACACACACATGATAG CCACTCCTTTCTCTAATGCCACAGAATTACACAGTCAACTCTC TAGTAGCAGCTGGCTGTCATGTGTCATTTGGCAATATCCATATC TTCCCCCCTTGCTGTAAA

  19. Genotype variation MICROSATELLITE Genotype Frequency (%) ETH152 AC AD BD BE CC CD CE DE 3,85 23,08 19,23 7,69 3,85 3,85 34,62 3,85 n 1 6 5 2 1 1 9 1 ETH225 AA AC AD BC BD BE CE DE 3,85 7,69 7,69 3,85 30,77 7,69 34,62 3,85 n 1 2 2 1 8 2 9 1 Genotype Frequency • ETH152 Highest CE 34,62%; lowest AC, CC CD, DE 3,85% • ETH225 Highest CE 34,62%; lowest AA, BC, DE 3,85%

  20. allel variation Microsatellite Allel Frequency A B C D E ETH152 0,13 0,13 0,25 0,25 0,23 ETH225 0,12 0,21 0,23 0,21 0,23 • Polymorphic   all allel frequency <0,99.

  21. • Analyse genotype vs phenotype? • Association?

  22. Other projects: •Sellection of Black rice by irradiation to get a new variety of black rice with shorter period of harvesting time and lowering plant size. •Gene markers for production traits in beef cattle. Work on growth homone gene and mitochondrial DNA •Comparative genetic diversity analysis of local zebu and the Fogera cattle by using microsatellite markers for enhancing milk production and climate change adaptation in selected production and model sites of western Amhara, Ethiopia (Kefyalew Alemayehu (kefyale@gmail.com), Professor Sutarno (nnsutarno@yahoo.com), Dr Sigit Prastowo)

  23. Body conformation influences on dairy cattle breeding goals Part of body confomation: body length, chest girth, and wither height, have 80-90% positive correlation with body weight Body weight is important factor to determine energy content in dairy cattle feed,  important for maintenance, reproduction as well as for milk production Age (Months) Parameter Size min 15-18 chest girth 155 cm wither height 121 cm body weight 300 kg Indonesian National Standard

  24. Microsatellite association with reproduction traits Microsatellite Traits Source In the chromosome 5 ETH152 Calving ease Schrooten et al. (2000) Validated in Dutch Holstein-Friesian population ETH225 Calving ease McClure et al. (2010) Related with calving ease and birth weight Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) BM1824 Weller et al. (2008) BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  25. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) In the chromosome 9 ETH225 Calving ease McClure et al. (2010) Validated in commercial Angus cattle Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 Associated with calving ease, birth weight, weaning and yearling weight, milk production INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) BM1824 Weller et al. (2008) BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  26. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) In the chromosome 2 Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 Validated in Dutch Holstein-Friesian population INRA032 Calving traits Seidenspinner et al. (2009) Suggestive linkage with calving ease, nonreturn post-insemination, milk production and body conformation Non return rate Reproduction Twinning Khatkar et al. (2004) BM1824 Weller et al. (2008) BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  27. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 In the chromosome 11 INRA032 Calving traits Seidenspinner et al. (2009) Validated in German Holstein families. Non return rate Reproduction Twinning Khatkar et al. (2004) Associated with calving trait and body conformation (hocks, rear leg set rear view) BM1824 Weller et al. (2008) BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  28. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) In the chromosome 11 BM1824 Weller et al. (2008) Validated in Israeli Holstein & French dairy cattle Associated with non return rate, twinning rate, milk production, birth and weaning weight BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  29. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) In the chromosome 7, 19, 23 BM1824 Weller et al. (2008) Validated in North American Holstein & Holstein cattle sires French BM1818 Twinning Cruickshank et al. (2004) Responsible for twinning rate, milk production and birth weight MM12 Reproduction de Oliveira et al. (2005)

  30. Microsatellite association with reproduction traits Microsatellite Traits Source ETH152 Calving ease Schrooten et al. (2000) ETH225 Calving ease McClure et al. (2010) Calving ease Non return rate Schrooten et al. (2000) Jemaa et al. (2008) BM2113 INRA032 Calving traits Seidenspinner et al. (2009) Non return rate Reproduction Twinning Khatkar et al. (2004) In the chromosome 9 BM1824 Study in Brangus-Ibagé cattle Weller et al. (2008) Related to ESR1 and IGF-1 gene which control the regulation of folliculogenesis and the reinitiation of postpartum cyclicity in beef cattle BM1818 Twinning Cruickshank et al. (2004) MM12 Reproduction de Oliveira et al. (2005)

  31. Thank You 11/18/2019 31

More Related