1 / 20

Molecular Evolution Sylvia Nagl

Molecular Evolution Sylvia Nagl. Sequence-structure-function paradigm. Relationships between DNA or amino acid sequence 3D structure protein functions Use of this knowledge for prediction of function, molecular modelling, and design (e.g., new therapies).

yuli-ramos
Download Presentation

Molecular Evolution Sylvia Nagl

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Evolution Sylvia Nagl

  2. Sequence-structure-function paradigm • Relationships between • DNA or amino acid • sequence 3D structure protein functions • Use of this knowledge for prediction of function, molecular modelling, and design (e.g., new therapies) CGCCAGCTGGACGGGCACACCATGAGGCTGCTGACCCTCCTGGGCCTTCTG… TDQAAFDTNIVTLTRFVMEQGRKARGTGEMTQLLNSLCTAVKAISTAVRKAGIAHLYGIAGSTNVTGDQVKKLDVLSNDLVINVLKSSFATCVLVTEEDKNAIIVEPEKRGKYVVCFDPLDGSSNIDCLVSIGTIFGIYRKNSTDEPSEKDALQPGRNLVAAGYALYGSATML

  3. A novel sequence or structurePrediction based on “similarity”= evolutionary relatedness

  4. Evolution as an algorithmic process Random mutation (genotype) “mutate” Selection (phenotype) “select” Differential reproduction “replicate” ‘cumulative’ The term algorithm denotes a certain kind of formal process consisting of simple steps that are executed repetitively in a defined sequential order and will reliably produce a definite kind of result whenever the algorithm is run or ‘instantiated.’

  5. Cumulative selection will work on almost anything that can yield similar, but non-identical, copies of itself through some replication process. • It depends on a medium that stores information and can be passed on to the next generation - DNA or RNA (virus) in terrestrial life forms. • Most genetic mutations are deleterious - proofreading and error correction mechanisms - negative selection • Whenever positive selection acts, it can be thought of as selecting DNA with particular phenotypic effects over others with different effects. • Advantageous mutations may confer a survival and reproductive advantage on individuals who will then, on average, pass on more copies of their genetic material because they will tend to have a larger number of offspring. • Over many generations, the accumulation of small changes can result in the evolution of DNA sequences with new associated phenotypic effects.

  6. Roadmap of the human genome Pseudogenes Gene fragments Introns, leaders, trailers Noncoding DNA 810Mb Genes and gene-related sequences 900Mb Coding DNA 90Mb Single-copy genes Tandemly repeated Multi-gene families Dispersed Regulatory sequences Satellite DNA Minisatellites Microsatellites Non-coding tandem repeats Repetitive DNA 420Mb Genome-wide interspersed repeats Extragenic DNA 2100Mb DNA transposons LTR elements LINEs SINEs Unique and low-copy number 1680Mb

  7. Multi-gene families: Evolution by gene duplication • Gene duplication is the most important mechanism for generating new genes and new biochemical processes. • This mechanism has facilitated the evolution of complex organisms: • In the genomes of eukaryotes, internal duplications of gene segments have occurred frequently. Many complex genes might have evolved from small primordial genes through internal duplication and subsequent modification. • Vertebrate genomes contain many gene families absent in invertebrates. • Many gene duplications have occurred in the early evolution of animals (“Biology’s Big Bang”, “Cambrian explosion”, ~570-505 million year ago).

  8. Types of duplication events • A duplication may involve • a single gene (complete gene duplication) • part of a gene (internal or partial gene duplication) • part of a chromosome (partial polysomy) • an entire chromosome (aneuploidy or polysomy) • the whole genome (polyploidy)

  9. Gene duplication: Mechanisms Unequal sister chromatid exchange at meiosis Unequal crossing-over at meiosis

  10. Gene duplication: Mechanisms Transposition via an RNA intermediate reintegration transcription reverse transcription RNA cDNA DNA transposons transposon replication

  11. Homology: Paralogy, orthology and xenology a duplication ‘Redundant copy’ a b paralogous speciation a b a b orthologous species 1 species 2

  12. Random mutation (genotype) “mutate” Selection (phenotype) “select” Differential reproduction “replicate” Duplication – mutation in ‘redundant copy’ – paralogy - new function

  13. Complete gene duplication deleterious mutations invariant repeats “tandem arrays” increased gene product Examples: large quantities of specific rRNAs or tRNAs, histone proteins amplified esterase gene in Culex mosquito variant repeats sequence divergence HOX/HOM genes function or regulation may differ Dayhoff (1978): at least 50% identity: gene family >35% identity: homologous (super)family pseudogene (silent)

  14. Evolution of Hox and HOM gene clusters by gene duplication mouse gene duplication Amphioxus hypothetical ancestor Drosophila Antennapedia Bithorax

  15. Internal gene duplication: Domain duplication • Duplicated gene segments often correspond to functionalorstructuraldomains. • A domain is a well-defined region within a protein that either performs a specific function or constitutes a stable structural unit. • Domain duplication is a form of internal duplication. • This mechanism may • increase number of active sites • enable acquisition of a new function by modifying the redundant segment. • Domain duplication increases the functional complexity of genes in evolution.

  16. Internal repeats in the apolipoprotein genes The structural and functional module: a 22-mer repeat In exon 4 of the genes belonging to this family, this 22-mer is repeated 1 to ~15 times. The presence of many copies lead to the evolution of new functions: apoE now plays a role in neural regeneration, immunoregulation, growth and differentiation, via interactions with low-density lipoprotein receptors and apoE receptors.

  17. Gene evolution by domain shuffling 1. Internal duplication Duplication of one or more domains 2. Domain insertion Structural or functional domains are exchanged between proteins or inserted into a protein “Mosaic or chimeric proteins”

  18. Examples: Two common domains Kringle domain from plasminogen protein EGF-like domain from coagulation factor X

  19. Domain insertion: “Mosaic proteins” Structural modules: Domain origins: epidermal growth factor (EGF) plasminogen kringle domain EGF domain fibronectin finger domain fibronectin vit. K-dependent calcium-binding domain (osteocalcin) trypsin-like serine protease Mosaic proteins tissue plasminogen activator prothrombin urokinase plasminogen

More Related