430 likes | 853 Views
Protein Expression Systems. Bacterial. Cell-free. Yeast. Mammalian. Insect. Protein Expression in Bacteria. Advantages/disadvantages Genetic elements essential for the expression Cloning strategies Overview of the available expression systems and expression strains
E N D
Protein Expression Systems Bacterial Cell-free Yeast Mammalian Insect
Protein Expression in Bacteria Advantages/disadvantages Genetic elements essential for the expression Cloning strategies Overview of the available expression systems and expression strains Design of cloning procedures using the VNTI program
Advantages • Fast growth • Cheap medium and equipment for growing • Good knowledge of the host
Disadvantages Limitation for expression of eukaryotic proteins due to: • different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs. • differences in post-translational modifications (SS bonds, glycosylation etc)
Disadvantages • Accumulation of lipopolysaccharides (generally referred to as endotoxins) …
Goals To obtain as much as possible /good expression+good cell growth soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression=danger of aggregation, decreased cell growth
RBS, START, and STOP Ribosome Bindind Site (RBS): RBS RBS 5-9 n START GAAGGAATTCAGGAGCCCTTCACCATG ... ... START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TGA (UGA), TAA (UAA)
Promoters Host’s promoters 2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD • Regulation of expression Promoters from phages T7, T3, SP6, T5, PL - Highly efficient and specific expression
Protein Expression in BacteriaPart2 Cloning strategies Overview of the available expression systems and expression strains Design of cloning procedures using the VNTI program
Cloning Using Restriction Enzymes NcoI HindIII
Directional Cloning CACC
Expression of Fusion Proteins • We may fuse the target protein with • various tags to facilitate its purification or detection HHHHHH-target, epitope-target • highly soluble proteins to improve solubility and to facilitate purification Thioredoxin-target, GST-target • signal peptides or other proteins or domains to promote secretion SP-target
‘Short’ Fusion Protein Construction ATG CAT CAC CAT CAC CAT CAC
‘Long’ Fusion Protein Construction NcoI HindIII PstI HindIII
pUC18/19 Transcriptional vector
pTrc99 Translational vector
pQE Translational vector +CDR
Expression optimization To optimase: Level of inducer (e.g. arabinose) Time of induction Temperature of the induction step (popular - 18oC overnight)