1 / 52

By JOSE ANIBAL CARDE-SERRANO

University of Puerto Rico Intercampus Doctoral Program in Biology. ENDOCRINE DISRUPTING CHEMICALS: EFFECTS AND MECHANISM OF ACTION IN VTG GENE EXPRESSION IN THE TROPICAL LIZARD Anolis pulchellus. By JOSE ANIBAL CARDE-SERRANO. University of Puerto Rico Intercampus Doctoral Program in Biology.

adanna
Download Presentation

By JOSE ANIBAL CARDE-SERRANO

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. University of Puerto Rico Intercampus Doctoral Program in Biology ENDOCRINE DISRUPTING CHEMICALS: EFFECTS AND MECHANISM OF ACTION IN VTG GENE EXPRESSION IN THE TROPICAL LIZARD Anolis pulchellus By JOSE ANIBAL CARDE-SERRANO

  2. University of Puerto Rico Intercampus Doctoral Program in Biology • Historical Background • 1950- DDT: estrogenic in birds. • 1962- “Silent Spring”- Rachel Carson • 1968- DDT: estrogenic in mammals • 1969- DDE: declining populations • 1972- DDT: banned in USA • 1971-80 DES: reproductive/developmental disorders in offspring of treated mothers.

  3. University of Puerto Rico Intercampus Doctoral Program in Biology • Historical Background … • 1977- PCBs: restricted by EPA • 1991- Plastic compounds: estrogenic • 1993- E E2: - Sperm counts declination • 1993- Sewage effluent: estrogenic • 1994- DDT: strikes back, Lake Apopka, Fl • 1996- “Our Stolen Future” Colborn et al. • 1999- eHormone- Tulane University

  4. University of Puerto Rico Intercampus Doctoral Program in Biology • Today’s Dilemma • Non-human species as environmental sentinels? • Appropriate species to assess EDCs in lab and field? • Which are important endpoints to monitor the effects? • In vitro vs In vivo approaches. • Definitions: • Endocrine Disrupting Chemicals (EDCs) • Xenoestrogens (XEs) • Endpoints

  5. University of Puerto Rico Intercampus Doctoral Program in Biology Estrogen Estriol Estrone Diethylstilbestrol op DDT Methoxychlor Bisphenol A Diehtylhexyl Pthalate Tamoxifen Structures of EDCs– (QSAR) E2 E1 E3 DES DDT MTX BPA DEHP TAM

  6. University of Puerto Rico Intercampus Doctoral Program in Biology Some EDCs and Their Effects

  7. University of Puerto Rico Intercampus Doctoral Program in Biology • The Model System: Anolis pulchellus - ♂ • Tropical lizards • Humid grassy areas • Night recollection • Easily maintained • Ubiquitous • Sentinel ?

  8. University of Puerto Rico Intercampus Doctoral Program in Biology • The Model System: Anolis pulchellus - ♀ • Vitellogenesis • Vitellogenins • Captivity Effects • mRNA/Vtg • Reverted by E2

  9. University of Puerto Rico Intercampus Doctoral Program in Biology E2- Mechanism of Action From Geneka Biotechnology http://www.biolynx.ca/active.html

  10. University of Puerto Rico Intercampus Doctoral Program in Biology • Objective I • In vivo induction of VTG expression in Anolis pulchellus lizards as indicator of estrogenic activity of suspected EDCs. • A - Transdermal treatment, E217β • B - Males • C- Females

  11. University of Puerto Rico Intercampus Doctoral Program in Biology Efficiency of Transdermal Treatment ★ H3 E217B-CPM (x106) 3.0 1.0 0 ★ Tip Skin Visc

  12. University of Puerto Rico Intercampus Doctoral Program in Biology Objective Ia -In vivo induction of VTG expression in Anolis pulchellus lizards transdermally treated with E217β. Male Lizards • E217β, EtOH95% • DDT, DDE, Mtx • DEHP, BPA • E1, E3, DES Western Blot Anti S1 (Vtg) RT-PCR

  13. University of Puerto Rico Intercampus Doctoral Program in Biology Minimal Dose for Estradiol 17B: Transdermal (TD) vs Intramuscular (IM) TD C- 0.0005 0.005 0.05 0.5 (μg) Vtg 169 153 116 Anti S1 (Vtg) IM C- 0.0005 0.005 0.05 0.5 (μg) Vtg 169 153 116 Anti S1 (Vtg)

  14. University of Puerto Rico Intercampus Doctoral Program in Biology Problem The need of model systems to be used as sentinel species and for the assessment of estrogenic activity in suspected EDCs. Hypothesis If Vtg is induced in lizard males by E217β, then the EDCs with XEs activity will also induce the Vtg gene expression. Similar mechanisms of action can be suspected.

  15. University of Puerto Rico Intercampus Doctoral Program in Biology Objective Ib -In vivo induction of VTG expression in Anolis pulchellus lizards as indicative of estrogenic activity of suspected EDCs. Males • E217β, EtOH95% • DDT, DDE, Mtx • DEHP, BPA • E1, E3, DES • 3Rxs every other day Treatments Western Blot Anti S1 (Vtg) RT-PCR

  16. University of Puerto Rico Intercampus Doctoral Program in Biology Effects of Pesticides on VTG synthesis DDT (μg) DDE (μg) Mtx (μg) 60 125 125 250 375 125 250 Vtg 169 153 116 Anti S1 (Vtg) 1 2 3 4 5 6 7

  17. University of Puerto Rico Intercampus Doctoral Program in Biology Effects of Plasticizers on Vtg Synthtesis DEHP (10 mg) C+ C- 2 3 4 Vtg 169 153 116 Anti S1 (Vtg) 1 2 3 4 5

  18. University of Puerto Rico Intercampus Doctoral Program in Biology Effects of Plasticizers on Vtg Synthtesis BPA (μg) 250 375 500 1000 C+ Vtg 169 153 116 Alb Anti S1 (Vtg) 1 2 3 4 5 6

  19. University of Puerto Rico Intercampus Doctoral Program in Biology Effects of Steroids and Non-steroids compound on VTG synthesis E217β E1 E3 DES 5 0.5 0.5 0.005 (μg) Vtg 169 153 116 Anti S1 (Vtg) 1 2 3 4

  20. University of Puerto Rico Intercampus Doctoral Program in Biology Objective Ic -In vivo induction of VTG expression in Anolis pulchellus lizards as indicative of estrogenic activity of suspected EDCs. Females Captivity - 15 days Treatment • EtOH 95% • DDT, DDE, Mtx Western Blot Anti S1 (Vtg) RT-PCR

  21. University of Puerto Rico Intercampus Doctoral Program in Biology Vtg Synthesis Reverted by Pesticides in Females C15 Glf DDT DDE Mtx - - - 1000 500 500 500 (μg) Vtg 169 153 116 Anti S1 (Vtg) 1 2 3 4 5 6 7 8

  22. University of Puerto Rico Intercampus Doctoral Program in Biology Vtg Synthesis Reverted by Pesticides in Females C15 Glf DDT DDE Mtx 1000 500 500 500 (μg) 500 300bp Vtg mRNA RT-PCR 1 2 3 4 5 6 7

  23. University of Puerto Rico Intercampus Doctoral Program in Biology Effect of Methoxychlor on Vtg Synthesis Mtx 70 μg C- C+ Vtg 169 153 116 Alb Anti S1 (Vtg) 1 2 3 4 5 6 7 8 9

  24. University of Puerto Rico Intercampus Doctoral Program in Biology Dose Response Experiments (a) Dead animals.

  25. University of Puerto Rico Intercampus Doctoral Program in Biology Conclusions • A transdermal mode of administration for E217β and suspected EDCs was developed and tested. • The expression of the Vtg gene de novo in males can be used as a confident endpoint of XEs activity in this totally terrestrial anoline lizard. • Pesticides as well as hormone-like compounds more likely to be effectively and accurately tested in this model system.

  26. University of Puerto Rico Intercampus Doctoral Program in Biology Objective II: A) To demonstrate that the effect on VTG expression that results from the E217β and EDCs treatment is mediated via the ER. B) To demonstrate the interaction of E217β and the EDCs with a plasma Sex Steroid Binding Protein (SSBP).

  27. University of Puerto Rico Intercampus Doctoral Program in Biology Objective IIa,b -To demonstrate the interaction of E217β with a liver ER and plasma SSBP. Males - RxsE217β Cytoplasmic Liver Protein Extraction (100xg) or Blood plasma Competitive Binding Assays SDS Page

  28. University of Puerto Rico Intercampus Doctoral Program in Biology 3[H]-E217β Binding to Intracelullar Proteins:ER ★ 8.0 6.0 4.0 2.0 0 H3 E217B-CPM (x106) ★ ★ ★ C NRx Rx

  29. University of Puerto Rico Intercampus Doctoral Program in Biology EDCs binding to Intracelullar Proteins: ER

  30. University of Puerto Rico Intercampus Doctoral Program in Biology Relative Binding of EDCs to ER HPTE 4-0HTam

  31. University of Puerto Rico Intercampus Doctoral Program in Biology EDCs binding to Plasma SSBP

  32. University of Puerto Rico Intercampus Doctoral Program in Biology Relative Binding of EDCs to SSBP

  33. University of Puerto Rico Intercampus Doctoral Program in Biology EDCs: Qualitative Ranking for Estrogenicity E3>DDT>E1=DES=DDE=BPA>Mtx>DEHP

  34. University of Puerto Rico Intercampus Doctoral Program in Biology Conclusions • The presence of an E217β binding activity (ER) was demonstrated in a liver cytosolic protein extract from Anolis pulchellus for the first time. The interaction of 5 of 9 EDCs/XEs with the putative ER was also shown by this binding assay. • The presence of an E217β binding activity (SSBP) was demonstrated in the blood plasma of the Anolis pulchellus for the first time. Interaction with some of the EDCs/XEs with the SSBP was also demonstrated. • EDCs that require metabolic activation (MTX/HPTE) are apparently appropriate for assessment in Anolis.

  35. University of Puerto Rico Intercampus Doctoral Program in Biology • Objective III • To determine if E2 activate the ER and if this ligand-receptor complex interact with an ERE from the VTG gene.

  36. University of Puerto Rico Intercampus Doctoral Program in Biology Objective III-To determine if E2 activate the ER and if this ligand-receptor complex interact with an ERE from the VTG gene. Males - E217β Cytoplasmic Liver Protein Extraction SDS Page EMSA

  37. University of Puerto Rico Intercampus Doctoral Program in Biology Electrophoretic Mobility Shift Assay (EMSA)

  38. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – ER -12hr - Anolis Extract : Old New C- 25 50 100 25 50 100 (μg) ER ? Free probe Pomega ERE_KC 1 2 3 4 1 2 3

  39. University of Puerto Rico Intercampus Doctoral Program in Biology Bioinformatics Analysis: ERE ERE_KC 5’ GTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT 3’ * - - - - * - - * - ** *** * - ** *** ** ** - - - * - - - - - ERE_CS

  40. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – ER*- Anolis/HeLa Extract : Anolis HeLa C- C+ SpC NspC C- C+ SpC NspC ER Free probe Promega *ERE_CS 1 2 3 4 5 1 2 3

  41. University of Puerto Rico Intercampus Doctoral Program in Biology Binding Buffers Comparison

  42. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – General Transcription Factors - Anolis TFII SP1 -UV +UV-UV +UV P RE KC C- P RE KC P RE KC C- P RE KC SP1 TFII Free probe 1 2 3 4 5 6 7 8 9 10 11 12 13 14

  43. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – ER- 4hr - Anolis♂ -UV +UV TFII P RE KC C- P RE KC ER Free probe 1 2 3 4 5 6 7 8 ERE_CS

  44. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – ER- 1hr- Anolis Extract : ♂ ♀ C+ SpC NSC C- C+ SpC NSC ER Free probe RE ERE_CS 1 2 3 4 5 6 7

  45. University of Puerto Rico Intercampus Doctoral Program in Biology EMSA – ER- Anolis Specific Competitor (fmoles) C- C+ 10 50 100 500 ER Free probe RE ERE_CS 1 2 3 4 5 6

  46. University of Puerto Rico Intercampus Doctoral Program in Biology Conclusions • The formation of an E217β-ER complex using the liver cytosolic protein extract, capable of the recognition of a consensus ERE for estrogen-regulated genes was demonstrated. Confirming the presence of an E217β binding activity (ER) in a liver cytosolic protein extract.

  47. University of Puerto Rico Intercampus Doctoral Program in Biology (1) Extracellular Milieu Detox Liver Cells Enzymes (2) (3a) (4) Vtg mRNA AAAAA Vtg protein (3b) ERE Nucleus Cytoplasm

  48. University of Puerto Rico Intercampus Doctoral Program in Biology Future Experiments • Binding assays with active metabolites of putative EDCs. • EMSAs with EDCs as activators or promoters of XE-ER-ERE complex formation. • Super shifts to identify and characterize transcription factors recruited in the ER-ERE complex in the presence or absence of XEs.

  49. University of Puerto Rico Intercampus Doctoral Program in Biology Agradecimientos • Dra. Magda H. Morales, por la oportunidad de trabajar con ella y aprender de ella. • Los doctores Dra. Sandra Peña de Ortiz, Dr. José Ramón Rodríguez Medina, Dr. Osvaldo Rosario y Dr. José Lasalde. • Dr. Carlos I. González, por su cooperación y dirección durante el último grupo de experimentos y por su hospitalidad en su laboratorio, asi como a su grupo trabajo. • Lorena Saavedra, Jhyoti Metha, Raúl Vázquez, Angel Pérez, Ivelisse Castresana, Abimael de León. • Rose Díaz, Juan Carlos Hernández, Nayda Ortiz, John Santiago, y José E. Vidal.

  50. University of Puerto Rico Intercampus Doctoral Program in Biology Agradecimientos • La Universidad Adventista de las Antillas, el Departamento de Ciencias y su Directora la Profesora Alicia Moradillos, asi como a mis colegas y estudiantes por su apoyo y cooperación durante este proyecto. • Mi esposa Lourdes, quién ha estado ahi al lado, luchando conmigo para lograr esta meta. Al lado de cada hombre de éxito … hay una mujer. • La Universidad de Puerto Rico, Recinto de Río Piedras, sus programas Faculty Development, SUBE, FIPI y DEGI. • A Dios, por que a los que a Dios aman, todas las cosas les ayudan a bien.

More Related