1 / 26

Roger Prichard Institute of Parasitology McGill University, Montreal, Canada

2007 – 2009 publications Macrocyclic lactone resistance: 1. Understanding resistance mechanisms to different MLs 2. Progress with possible markers for ML resistances. Roger Prichard Institute of Parasitology McGill University, Montreal, Canada. Ligand-gated ion channels.

adora
Download Presentation

Roger Prichard Institute of Parasitology McGill University, Montreal, Canada

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 2007 – 2009 publicationsMacrocyclic lactone resistance:1. Understanding resistance mechanisms to different MLs2. Progress with possible markers for ML resistances Roger Prichard Institute of Parasitology McGill University, Montreal, Canada

  2. Ligand-gated ion channels

  3. H. contortus GluClα3B expressed in Xenopus oocytes The effects of ivermectin resistance-associated mutations on the ability of glutamate to activate H. contortus GluCl3B channels (mean SEM) Mutation EC50 for L-Glutamate Hill Number Wild type 27.6 ±2.7 1.89 ± 0.35 E114G 31.5 ± 3.2 1.48 ± 0.31 V235A 26.2 ± 2.5 1.97 ± 0.35 L256F 92.2 ± 3.5*** 1.09 ± 0.16** T300S No channels ** p 0.01, *** p 0.001 Fig. 4. Dose-response curves for L-glutamate at mutant H. contortus GluClα3B channels. , wild-type; ✖, V235A; , E114G; , L256F. McCaverna et al. Mol. Pharmacol. 2009

  4. Radioligand binding assays using [3H]ivermectin and membrane preparations from COS-7 cells transfected with wild-type and mutant H. contortus GluClα3B. The insets show the Scatchard plots for each mutant. McCaverna et al. Mol. Pharmacol. 2009 The effects of mutations in H. contortus GluClα3B on binding of 3[H]ivermectin to membrane preps from transfected COS-7 cells. Mean± SEM Mutation Kd 3[H]Ivermectin Binding, nM Wild type 0.35 ± 0.1 E114G 0.39 ± 0.07 V235A 0.32 ± 0.09 L256F 2.26 ± 0.78*** L256W 2.51 ± 0.7*** L256Y 1.84 ± 0.49*** L256V 0.79 ± 0.24* T300S 0.76 ± 0.25 * p< 0.05; *** p< 0.001

  5. Annelies Van Zeveren in her Ph.D. studies looked for the L256F SNP, in GluClα3 homolog, in an ivermectin resistant strain of Ostertagia ostertagi that she and her colleagues had experimentally selected, but did not find the L256F mutation. L256F, in GluClα3, may be quite rare in different nematode isolates. However, if it does occur it does seem to produce an ‘IVM-resistance phenotype’

  6. A dopamine-gated ion channel (HcGGR3*) from Haemonchus contortus is expressed in the cervical papillae and is associated with macrocyclic lactone resistance Rao VT, Siddiqui SZ, Prichard RK, Forrester SG. Mol Biochem Parasitol. 2009 Jul;166(1):54-61. Epub 2009 Mar 4.

  7. Electrophysiology of HcGGR3 in Xenopus laevis oocytes Response to dopamine Response to other amines HcGGR3 forms a homomeric channel and is primarily gated by dopamine Rao et al. Mol. Biochem. Parasitol. 2009

  8. Expression of HcGGR3 in lab macrocyclic lactone (ML)-selected strains of Haemonchus contortus (♀) qPCR: Standard curve relative quantification method Fold change as compared to expression in PF23 strain (normalized with 18srRNA) Level of expression in PF23 strain anova: P<0.0001 PF23: ML sensitive strain IVF23&MOF23: Lab selectedstrains HcGGR3 is down regulated in lab strains of ML- selected worms Rao et al. Mol. Biochem. Parasitol. 2009

  9. Genotyping of Hcggr3 for the region encoding 3’ UTR (single ♂s) GGTGGGTAAACGATAGATCAACTATATCGCACATAAAAAATACAATGCAAACACATATTTTGTAAACGTTAATTCCACCGTAGCCAATTAACCGTATAAATATGCAATTCAACCTAATTGAGTTGCATTATCACATTCGTTGATTTCTCTAAATGTAGAGAGTTGAGGAG Homozygous: T/T Heterozygous: T/C Rao et al. Mol. Biochem. Parasitol. 2009 PF23: ML sensitive strain IVF23&MOF23: Lab selected strains N = 30 Selection of HcGGR3 allele in Macrocyclic lactone resistance

  10. Pharyngeal pump rates of wild-type C. elegans after 2.5 h exposure to 2-fold serial dilutions of IVM and MOX (mean ± SD). A circle ( ) represents pumping rate in non-treated worms, a triangle ( ) indicates pumping rate in IVM exposed worms and a square ( ) indicates pumping rate in MOX exposed worms. Ardelli et al. 2009 Vet Parasitol

  11. Motility phenotype of wild-type C. elegans after exposure to 2.5 nM of drug (mean ± SD). A circle ( ) represents velocity in non-treated worms, a triangle ( ) indicates velocity in IVM exposed worms and a square ( ) indicates velocity in MOX exposed worms Ardelli et al. 2009 Vet Parasitol

  12. Transcriptional profiles of GluCl genes in wild-type C. elegans after exposure to 2.5 nM of IVM or MOX for 2h (mean ± SD). The black bars represent gene transcription after exposure to IVM and the grey bars represent gene transcription after exposure to MOX. The y-axis represents the fold change in transcription relative to non-treated controls and listed along the x-axis is the C. elegans gene. Changes that are statistically different between the drug treatments (p < 0.05) following IVM or MOX exposure are indicated with . Ardelli et al. 2009 Vet Parasitol

  13. ABC transporters

  14. Half-transporters Merino et al. Drug Met. Disp. 2009 Natural Allelic Variants of Bovine ATP-Binding Cassette Transporter ABCG2: Increased Activity of the Ser581 Variant and Development of Tools for the Discovery of New ABCG2 Inhibitors Selamectin was a significantly more potent inhibitor of the Tyr581 variant compared with the wild-type Ser581 Effect of the ivermectin (IVE) and selamectin (SEL)] on mitoxantrone (MXR) accumulation mediated by human ABCG2 and murine Abcg2. Transduced MDCKII cells were preincubated with or without Ko143 (1 µM) or the other tested compounds (50 µM). Mean MXR fluorescence is shown in terms of relative arbitrary units. The bars indicate the means ± S.D. ** p< 0.01, comparing the difference between human ABCG2- and murine Abcg2- transduced MDCKII cells. §§, p< 0.01, comparing the difference between IVE and SEL in murine Abcg2-transduced cells. §§§, p< 0.001, comparing the difference between IVE and SEL in human ABCG2-transduced cells.

  15. IVM selection on C. elegans Cross-resistance to anthelmintics. C. elegans L1s in M9 buffer were incubated in serial dilutions of moxidectin (MOX), levamisole (LEV), albendazole (ALB) or pyrantel (PYR), and their fold-resistance determined in IVR6 (solid) and IVR10 (hatched) relative to Bristol N2 strain (1; dotted line). James & Davey, Int. J. Parasitol. 2008

  16. ‘Natural’ IVM resistance in C. elegans results in overexpression of a number of ABC transporter genes (Pgps & mrps) ABC transporter gene expression in ivermectin-resistant Caenorhabditis elegans. pgp-1, pgp-2, mrp-1, mrp-2, mrp-5 and mrp-6 were amplified from cDNA using gene-specific primers in IVR6 (solid) and IVR10 (hatched) strains cultured with ivermectin. James & Davey, Int. J. Parasitol. 2008.

  17. c-glutamylcysteine synthetase (gcs-1), the rate-limiting enzyme for glutathione synthesis was overexpressed in IVR10, while a glutathione transferase π(gstp-1) was overexpressed in IVR6 The expression of gcs-1 and gstp-1 (B) was examined in IVR6 (solid) and IVR10 (hatched) strains cultured on ivermectin. Bars show means ± SD of the fold change in gene expression relative to the Bristol N2 strain from 2 independent experiments. * indicates P≤0.05; ** indicates P≤0.01. James & Davey, Int. J. Parasitol. 2008.

  18. Allelic variation in an Onchocerca volvulus ABC transporterwas reduced in IVM-treated human populations in Ghana in 1999 Ardelli & Prichard, Trans R Soc Trop Med Hyg. 2007, 101:1223

  19. PLP (half-transporter) Genotype before IVM and after 13X IVM: Onchocerca volvulus BEFORE IVM AFTER IVM 13x P=0.054 50 45 40 P=0.029 35 Frequency 30 P=0.0077 25 20 P=0.048 15 P=0.048 Fisher’s exact test 10 5 0 AA GG TT AG GG TT AG CG TT GG CG TT AA CC AA GG GG TT AG CG AT AA CG AA AG GG AT AG CG AA AG GG AA GG GG AT AG CC AA Female worms Position 1 =AA/AG/GG Position 2 =CC/CG/GG Position 4 =AA/AT/TT Pre IVM= 66 Post IVM=35 Allelic selection after 13 three-monthly doses of IVM in female worms Loss of polymorphism. Bourguinat et al. 2008 Mol Biochem Parasitol

  20. Mrp expression in C. elegans following exposure to 2.5 nM IVM, compared with wild-type worms not exposed to drug Mrp expression in C. elegans following expsure to 2.5 nM MOX, compared with wild-type worms not exposed to drug B Ardelli & Prichard J. Helminthol. in press

  21. Thioredoxins and IVM resistance Analysis of H. contortus showed that expression of both thioredoxin 12-kDa (HcTrx1) and the 16-kDa (HcTrx3) genes were increased in an IVM-resistant strain relative to a sensitive strain. Sotirchos, Hudson , Ellis & Davey. Free Radic Biol Med. 2008

  22. β-tubulin and ML resistance

  23. β-tubulin H. contortus: Comparison of the frequency of 200TTC-phenylalanine, 200TTC/TAC-phenylalanine/tyrosine and 200TAC-tyrosine in unselected (PF), IVM selected (IVF) and MOX selected (MOF) strains Tyr at amino acid 167 or 200: PF = 11.1%; IVF = 48.1%; MOF = 51.9% Mottier & Prichard 2008 Pharmacogenetics & Genomics

  24. BEFORE TX AFTER TX Before and after 13 three-monthly doses P=1e-8 Fisher’s exact test P=1e-6 80 60 Frequency 40 20 0 aa ab bb Genotype Onchocerca volvulus: β- tubulin Female worms after 13 x IVM N before=183 N after 4 doses=59 N after 13 doses=39 IVM selection caused a significant change in β-tubulin genotype Bourguinat et al. 2007 PLoS NTD

  25. TAC/TTC in H. contortusβ-tubulin in Swedish flocks which had been under BZ or ML treatment “An allele frequency of ≥65% was detected in one of the two flocks in 13 (29%) of the 45 farms examined. On many farms (24, 25, 33, 36, 37, 39, 42, 43 and 44) the allele frequency was similar in both the BZ and ML treated flocks” Höglund et al. Vet Parasitol, 2009

  26. Conclusions • ML resistances appear to be multigenic • Phenotypic effects of IVM & MOX markedly different • Differences in genes implicated in IVM & MOX resistances • Possibly GluCls involved in ML resistances, but data not conclusive • ABC transporters induced & overexpressed in ML resistances, but not same between IVM & MOX • MLs select on β-tubulin • Thioredoxins may also be overexpressed in ML resistances

More Related