1 / 11

A Lot More Advanced Biotechnology Tools (Part 2)

A Lot More Advanced Biotechnology Tools (Part 2). Sequencing . Human Genome Project. On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event! blueprint of a human the potential to change science & medicine.

afi
Download Presentation

A Lot More Advanced Biotechnology Tools (Part 2)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A Lot More Advanced Biotechnology Tools(Part 2) Sequencing

  2. Human Genome Project On June 26, 2001, HGP published the “working draft” of the DNA sequence of the human genome. Historic Event! • blueprint of a human • the potential to change science & medicine

  3. Sequence of 46 Human Chromosomes 3G of data 3 billion base pairs

  4. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTTACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome3.2 billion bases

  5. Raw genome data

  6. NCBI GenBank Database of genetic sequences gathered from research Publicly available on Web!

  7. Organizing the data

  8. gene protein gene RNA polypeptide 1 gene polypeptide 2 polypeptide 3 Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 It’s hard to hunt for wabbits, if you don’t knowwhat a wabbitlooks like.

  9. And we didn’t stop there…

  10. The Progress 122+ bacterial genomes first metazoan complete (flatworm) first eukaryote complete (yeast) 17 eukaryotic genomes complete or near completion including Homo sapiens, mouse and fruit fly First 2 bacterial genomes complete # of DNA base pairs (billions) in GenBank Official “15 year” Human Genome Project: 1990-2003. Data from NCBI and TIGR (www.ncbi.nlm.nih.gov and www.tigr.org )

  11. How does the human genome stack up?

More Related