1 / 54

Chapter 17

Chapter 17. From Gene to Protein. DNA structure = double helix DNA sugar = deoxyribose DNA bases = A, T, C, & G A T C T C G A G T C G A T T A G A G C T C A G C T A. DNA. RNA structure = usually single stranded RNA sugar = ribose

agnes
Download Presentation

Chapter 17

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chapter 17 From Gene to Protein

  2. DNA structure = double helix DNA sugar = deoxyribose DNA bases = A, T, C, & G A T C T C G A G T C G A T T A G A G C T C A G C T A DNA

  3. RNA structure = usually single stranded RNA sugar = ribose RNA bases = A, U (uracil), C, & G (no thymine) DNA sequence: A T C T C G A G T C G A T RNA sequence: U A G A G C U C A GC U A RNA

  4. gene – a short sequence of DNA that codes for a specific piece of information The Connection Between Genes & Proteins

  5. Beadle and Tatum proposed the one gene – one enzyme hypothesis one gene – one enzyme hypothesis – states that the function of a gene is to produce a specific enzyme The Connection Between Genes & Proteins

  6. As researchers have learned more about enzymes and proteins their hypothesis is better stated as the one gene –one polypeptide hypothesis We now know that genes provide the instructions for making proteins each gene is usually hundreds or thousands of nucleotides long The Connection Between Genes & Proteins

  7. Transcription – the process by which genetic information is copied from DNA to RNA results in a single stranded RNA molecule that is carried from the nucleus to the cytoplasm Making Proteins From DNA

  8. Promoter Transcription unit 5 3 3 5 Start point RNA polymerase The Stages of Transcription DNA

  9. Steps of Transcription RNA polymerase binds to a specific region on the DNA called a promoter Making Proteins From DNA

  10. 1 Promoter Transcription unit 5 3 3 5 Start point RNA polymerase Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 5 3 3 5 Template strand of DNA Unwound DNA RNA transcript The Stages of Transcription DNA

  11. Making Proteins From DNA Steps of Transcription • RNA polymerase binds to a specific region on the DNA called a promoter • This causes the DNA to separate

  12. 2 1 Promoter Transcription unit 5 3 3 5 Start point RNA polymerase Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 5 3 3 5 Template strand of DNA Unwound DNA RNA transcript Elongation. The polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5 3 . In the wake of transcription, the DNA strands re-form a double helix. Rewound RNA 5 3 3 5 3 5 RNA transcript The Stages of Transcription DNA

  13. Making Proteins From DNA Steps of Transcription • RNA polymerase binds to a specific region on the DNA called a promoter • This causes the DNA to separate • RNA polymerase adds nucleotides one by one forming a new RNA molecule until it reaches a termination (or “stop”) signal • The newly formed strand is called mRNA • mRNA – a single uncoiled chain of RNA nucleotides that carries genetic information to the ribosome for protein production • mRNA travels from the nucleus to the ribosome for protein synthesis

  14. Transcription Video Real Time Transcription Video Making Proteins From DNA

  15. Translation – the process of making polypeptides (proteins) using mRNA as a template the mRNA is converted into a sequence of amino acids, which makeup proteins Making Proteins From DNA

  16. Translation – the process of making polypeptides (proteins) using mRNA as a template the mRNA is converted into a sequence of amino acids, which makeup proteins the mRNA is broken up into segments of 3’s called codons codon – a sequence of 3 nitrogen bases in mRNA that code for an amino acid Making Proteins From DNA

  17. codon – a sequence of 3 nitrogen bases in mRNA that code for an amino acid the sequence of codons along the mRNA is decoded into a sequence of amino acids which make up the polypeptide chain Making Proteins From DNA

  18. DNA molecule Gene 2 Gene 1 Gene 3 DNA strand (template) 5 3 A C C A A A C C G A G T TRANSCRIPTION G U G G U G C A U U U C 5 3 mRNA Codon TRANSLATION Gly Phe Protein Ser Trp Amino acid Figure 17.4 The triplet code

  19. Example: mRNA = CUGCUAGCUAGCUUCGAUCGAUGA a.a. = Leu- Leu- Ala- Ser- Phe- Asp - Arg- Stop Making Proteins From DNA

  20. Summary: DNA → RNA → Protein DNA = TACTCGATGGATTCGAACTCGATC RNA = AUGAGCUACCUAAGCUUGAGCUAG a.a = Meth- Ser- Tyr- Leu- Ser- Leu- Ser- stop Summary

  21. Transcription has 3 main steps: Initiation Elongation Termination Transcription in More Detail

  22. Promoter Transcription unit 5 3 3 5 Start point RNA polymerase Initiation

  23. Initiation Each DNA sequence has a region called the promoter promoter – A region of DNA where RNA polymerase attaches and initiates transcription sometimes called a promoter gene After the promoter is recognized the RNA polymerase attaches to it RNA polymerase – an enzyme that adds nucleotides to the growing chain of RNA during transcription Once the polymerase is attached transcription can continue Transcription in More Detail

  24. Elongation RNA polymerase moves along the DNA and adds nucleotides to the growing RNA molecule Transcription in More Detail

  25. Termination Transcription continues until the RNA polymerase reaches a DNA sequence called a terminator Transcription in More Detail

  26. The RNA sequence made by transcription is not ready for translation. It must first be modified. Pre-mRNA modification, called Gene Splicing The average length of a RNA molecule made by transcription is 8000 nucleotides. However, it takes only 1200 nucleotides to code for the average protein. What does this tell you? It means that the mRNA has long nucleotide sequences that don’t code for genes Preparing the RNA Sequence for Protein Production

  27. introns – a noncoding segment of nucleic acid that lie between coding segments of nucleic acids exons – coding segments of nucleic acids that are eventually translated into amino acids Preparing the RNA Sequence for Protein Production

  28. The introns need to be cut from the RNA molecule and the exons joined together to form a mRNA molecule with a continuous coding sequence that can go on to translation spliceosome – molecule that cuts the introns out and joins exons back together Preparing the RNA Sequence for Protein Production

  29. We learned that DNA is converted into a long strand of pre-mRNA. The pre-mRNA strand is the then modified by gene splicing (cutting introns out) to get the mRNA strand that is carried to the cytoplasm for protein synthesis translation – the process of making polypeptides (proteins) using mRNA as a template Translation

  30. Key terms to know codon – a sequence of 3 nitrogen bases in mRNA that code for a specific amino acid AUG – the start codon codon found on every functioning mRNA codes for the amino acid methionine UAA, UAG, or UGA – stop codons Translation

  31. Key terms to know rRNA – consists of RNA nucleotides that join proteins to make up the ribosome Translation

  32. Key terms to know tRNA – a single strand of about 80 RNA nucleotides that carries amino acids to the ribosome for protein synthesis Translation

  33. 3 A Amino acid attachment site C C 5 A C G C G C G U G U A A U U A U C G * G U A C A C A * A U C C * G * U G U G G * G A C C G * C * A G U G * * G A G C Hydrogen bonds G C U A G * A * A C * U A G A Anticodon (a) Two-dimensional structure. The four base-paired regions and three loops are characteristic of all tRNAs, as is the base sequence of the amino acid attachment site at the 3 end. The anticodon triplet is unique to each tRNA type. (The asterisks mark bases that have been chemically modified, a characteristic of tRNA.) Figure 17.14 The structure of transfer RNA (tRNA)

  34. Key terms to know anticodon – a region on the tRNA consisting of 3 bases complementary to the codon of mRNA Translation

  35. Amino acid attachment site 5 3 Hydrogen bonds A A G 3 5 Anticodon Anticodon (c) (b) Three-dimensional structure Symbol used in this book tRNA

  36. Steps of Translation 1. Initiation

  37. Initiation the ribosome binds to the mRNA at the start codon AUG the tRNA carrying the amino acid methionine binds to the mRNA strand where the start codon AUG is located Steps of Translation

  38. Large ribosomal subunit P site 3 5 U C A Met Met 5 3 A G U Initiator tRNA GDP GTP E A mRNA 5 5 3 3 Start codon mRNA binding site Small ribosomal subunit Translation initiation complex A small ribosomal subunit binds to a molecule of mRNA. In a prokaryotic cell, the mRNA binding site on this subunit recognizes a specific nucleotide sequence on the mRNA just upstream of the start codon. An initiator tRNA, with the anticodon UAC, base-pairs with the start codon, AUG. This tRNA carries the amino acid methionine (Met). The arrival of a large ribosomal subunit completes the initiation complex. Proteins called initiation factors (not shown) are required to bring all the translation components together. GTP provides the energy for the assembly. The initiator tRNA is in the P site; the A site is available to the tRNA bearing the next amino acid. 1 2 Figure 17.17 The initiation of translation

  39. Steps of Translation • Elongation

  40. Elongation amino acids are add one by one to the first amino acid methionine translocation – the process of mRNA moving along the ribosome making the polypeptide chain elongation continues to occur until the polypeptide is complete Steps of Translation

  41. 1 Codon recognition. The anticodon of an incoming aminoacyl tRNA base-pairs with the complementary mRNA codon in the A site. Hydrolysis of GTP increases the accuracy and efficiency of this step. Amino end of polypeptide DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide E mRNA 3 Ribosome ready for next aminoacyl tRNA P A site site 5 2 GTP GDP 2 E E P A P A 2 Peptide bond formation. An rRNA molecule of the large Subunit catalyzes the formation of a peptide bond between the new amino acid in the A site and the carboxyl end of the growing polypeptide in the P site. This step attaches the polypeptide to the tRNA in the A site. GDP Translocation. The ribosome translocates the tRNA in the A site to the P site. The empty tRNA in the P site is moved to the E site, where it is released. The mRNA moves along with its bound tRNAs, bringing the next codon to be translated into the A site. 3 GTP E P A Figure 17.18 The elongation cycle of translation

  42. Release factor Free polypeptide 5 3 3 3 5 5 Stop codon (UAG, UAA, or UGA) The two ribosomal subunits and the other components of the assembly dissociate. When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA. The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome. 1 2 3 Figure 17.19 The termination of translation

  43. Termination elongation continues until a stop codon is reached UAA, UAG, or UGA don’t code for an amino acid the polypeptide is released from the ribosome the mRNA and ribosome disassemble Steps of Translation

  44. Release factor Free polypeptide 5 3 3 3 5 5 Stop codon (UAG, UAA, or UGA) The two ribosomal subunits and the other components of the assembly dissociate. When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA. The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome. 1 2 3 Figure 17.19 The termination of translation

  45. DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide Amino acids Polypeptide tRNA with amino acid attached Ribosome Trp Phe Gly tRNA C C C G G Anticodon A A A A G G G U G U U U C Codons 5 3 mRNA Figure 17.13 Translation: the basic concept Translation Video Real Time Translation

  46. DNA = TACGTCAGCTCCTAGTACGCTACTG Review

  47. DNA = TACGTCAGCTCCTAGTACGCTACTG AUGCAGUCGAGGAUCAUGCGAUGAC Review pre-mRNA Intron Intron

  48. DNA = TACGTCAGCTCCTAGTACGCTACTG AUGCAGUCGAGGAUCAUGCGAUGAC Review pre-mRNA Intron Intron mRNA = A U G C A C G A G A U G C G A U G A C

  49. DNA = TACGTCAGCTCCTAGTACGCTACTG AUGCAGUCGAGGAUCAUGCGAUGAC Review pre-mRNA Intron Intron mRNA = A U G C A C G A G A U G C G A U G A C U A C a.a. = Met tRNA

  50. DNA = TACGTCAGCTCCTAGTACGCTACTG AUGCAGUCGAGGAUCAUGCGAUGAC Review pre-mRNA Intron Intron mRNA = A U G C A C G A G A U G C G A U G A C U A C G U G a.a. = Met -- His tRNA

More Related