Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

1. Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar, Roberto Tinoco, Rich WilsonFacilitators: Lisa Elfring and Ralph Preszler

2. Topic: Gene Expression: Linking Genes to Phenotypes Context:Majors General Biology, 150+ students, mixed preparation, high DFW rate, different fields (ex, pre-health), diverse socioeconomic and ethnic groups, students at a state university Prior Knowledge: Protein structure, Mendelian genetics, transcription, translation

3. Unit Learning Goals: • Understand the link between gene and phenotype • Understand how a mutation in DNA affects the amino acid sequence • Understand that a change in amino acid sequence can result in changes in protein function • Develop science process skills

4. Teachable Tidbit Learning Outcomes: A. Give examples of how genotypic changes can lead to phenotypic changes (1) B. Given a wild type and mutant amino acid and/or mRNA sequences, identify the type of mutation that occurred (2) C. Compare and contrast the effects of different mutations on the resulting amino acid sequence (4) D. Design an experiment to test how amino acid sequence affects protein function (5) E. Draw a concept map that illustrates the relationships between genes and phenotypes (5) F. Interpret graphical data about biological phenomenon (4)

5. Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

7. Q1: What is Ryan’s genotype? A. He is homozygous for the normal allele. B. He is heterozygous. C. He is homozygous for the mutant allele. D. He is hemizygous.

8. Q2: Which of the following contributes to sickle cell disease in Ryan? A. O2 levels B. Mutated DNA C. Abnormal protein D. All of the above E. Not enough information

10. GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA!

11. GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA! Ryan’s normal allele 5’ … CTATGGTGCACCTGACTCCTGAGGAGAAGT … 3’ Ryan’s mutant allele 5’ … CTATGGTACACCTGACTCCTGTGGAGAAGT … 3’

12. Q3: Rank the following mutations (from low to high) with regards to the severity of their impacts on the final protein: • nonsense early in sequence • silent • missense mutation of valinefor alanine • missense mutation of valinefor lysine. A. 1, 2, 3, 4 B. 2, 3, 4, 1 C. 1, 2, 4, 3 D. 2, 3, 1, 4 E. 2, 4, 3, 1

14. Q4: In each of Ryan’s red blood cells, what type of hemoglobin proteins are present? A. Normal and mutant hemoglobin B. Mutant hemoglobin C. Normal hemoglobin D. None since they lack nucleus E. It depends on oxygen levels

15. Take-Home Activity For each treatment type, place an X in the box(s) that the treatment will resolve. Targets Treatment Type

16. Alignment and Assessment • See hand-out

17. Diversity • Highlight role model from an under-represented group • Disease range vs. homework question • Inequality in access to healthcare • Pedagogical diversity: group work, think-pair-share, data interpretation, concept maps, visual-auditory

18. Assessment examples – Clicker questions and exam questions (concept map and experiment)

19. Alignment Diversity:

20. Think-Pair-Share How could this amino acid substitution change the shape of the protein and the cell? Protein Cell Image Source: Berkley’s “Understanding Evolution” Image Source: www.medindia.net

21. Mutation