1 / 31

Is behavior caused by genes or environment?

Is behavior caused by genes or environment?. Is behavior caused by genes or environment? Can the environment influence the function of genes?. Gene sequence is inherited (you’re stuck with what you have). atgtcagccgataactgactgatcgtaaattgagtttt. gene. However:

ainslie
Download Presentation

Is behavior caused by genes or environment?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Is behavior caused by genes or environment?

  2. Is behavior caused by genes or environment? Can the environment influence the function of genes?

  3. Gene sequence is inherited (you’re stuck with what you have) atgtcagccgataactgactgatcgtaaattgagtttt gene However: Gene expression is influenced by inheritance AND age, tissue type, physical environment and social environment protein “gene expression” = mRNA abundance messenger RNA (mRNA) atgtcagccgataactgactgatcgtaaattgagtttt gene

  4. Variation in gene sequence (DNA polymorphisms) can be found by “gene mapping” and DNA sequencing atgtcagccgataactgactgatcgtaaattgagtttt atgtcagccgataactgactgatggtaaattgagtttt DNA polymorphism Variation in gene expression can be found using “microarrays” protein “gene expression” = mRNA abundance messenger RNA (mRNA) Microarrays measure mRNA abundance for 1000s of genes simultaneously atgtcagccgataactgactgatcgtaaattgagtttt gene

  5. Behavioral division of labor in the honey bee colony

  6. Behavioral division of labor in the honey bee colony

  7. Behavioral division of labor in the honey bee colony Age at onset of foraging is socially regulated 50 40 30 % introduced bees that initiated foraging by day 14 20 10 10 20 30 40 % old foragers in colony

  8. Behavioral division of labor in the honey bee colony Age at onset of foraging is socially regulated Inhibitory social pheromone Forager Nurse

  9. Behavioral division of labor in the honey bee colony Age at onset of foraging is also genetically variable 60 % of introduced bees foraging at 15 days of age 40 20 0 m c l m c l m c l Introduced bees Host colony m c l m, c and l are different genetic strains

  10. Honey bee brain microarray Each pair of spots is a “detector” for mRNA abundance for 1 bee gene. We can analyze mRNA abundance for ~5500 different genes at the same time (in a single dissected bee brain)

  11. Comparing gene expression in a nurse brain vs. a forager brain Dissected nurse brain Dissected forager brain labeling reaction microarray hybridization Forager mRNA level Nurse mRNA level

  12. Do age-related changes in behavior involve changes in gene expression in the brain? “Typical” host colonies (ca. 40,000 mixed-age bees) Collect marked bees day 7 day 30 ~700 one-day-old bees (marked) Young nurses (n = 18) Old foragers (n = 18)

  13. YN OF Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager About 1/3 of genes expressed in the bee brain show differences in expression! But… Are gene expression differences really associated with behavior differences or with age? Genes Bee brains

  14. YN OF Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse OF = old forager About 1/3 of genes expressed in the bee brain show differences in expression! Genes Bee brains

  15. Changing age-demography in the colony (i.e., social environment) allows us to collect “precocious” young forgers and “over-aged” old nurses Collect marked bees ~1500 one-day-old bees (marked) All bees are same age!!! day 7 day 30 Young nurses (n = 6) Old nurses (n = 6) Young foragers (n = 6) Old foragers (n = 6)

  16. YN OF OF YN YF ON Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse YF = young forager ON = old nurse OF = old forager Genes Gene expression was primarily associated with behavior, not age! Bee brains

  17. YN OF OF YN YF ON Yellow = high mRNA abundance Blue = low mRNA abundance YN = young nurse YF = young forager ON = old nurse OF = old forager Genes Bee brains

  18. Although 1/3 genes show differences, only ~50 genes are needed to “predict” whether a bee is a nurse or a forager (Whitfield, Cziko & Robinson. Science 2003, 302: 296) Y = young (7 ±2 days) O = old (30 ±2 days) N = Nurse F = Forager Single-cohort (age-matched) bees Typical colony bees >2 1.5 1.25 1 0.8 0.67 <0.5 mRNA level

  19. Is gene expression in the brain a cause or consequence of behavior? ? • Brain gene expression • Upstream regulation of behavior Behavior -- or -- ? • Brain gene expression • Consequence of behavioral activity, experience or environmental differences Behavior

  20. Is gene expression in the brain a cause or consequence of behavior? Direct test of causation: Manipulate gene expression in brain Effects on behavior?

  21. Is gene expression in the brain a cause or consequence of behavior? Direct test of causation: Manipulate gene expression in brain Can’t do this yet – need transgenics!!! Effects on behavior?

  22. Is gene expression in the brain a cause or consequence of behavior? ? • Brain gene expression • Upstream regulation of behavior Behavior -- or -- ? • Brain gene expression • Consequence of behavioral activity, experience or environmental differences Behavior

  23. Brain gene expression in the absence of task-related experience Caged bees (no task-related experiences)

  24. Brain gene expression in the absence of task-related experience Social cue or treatment that accelerates the onset of foraging Forager-like changes in brain gene expression? Caged bees (no task-related experiences)

  25. Brain gene expression in the absence of task-related experience Social cue or treatment that accelerates the onset of foraging Forager-like changes in brain gene expression? Social cue or treatment that delays the onset of foraging Nurse-like changes in brain gene expression? Caged bees (no task-related experiences)

  26. Juvenile hormone analog (methoprene) accelerates the onset of foraging and causes forager-like changes in brain gene expression (in the absence of experience) “marker” genes Treat with methoprene (JH analog) Caged bees (no task-related experiences) Whitfield CW et al. PNAS. 2006. Oct 31; 103(44):16068-75.

  27. Queen mandibular pheromone (QMP) delays the onset of foraging and causes nurse-like changes in brain gene expression (in the absence of experience) “marker” genes Treat with QMP Caged bees (no task-related experiences) Grozinger CM, Sharabash NM, Whitfield CW, Robinson GE. PNAS. 2003. Nov 25; 100:14519

  28. Is behavior caused by genes or environment? Can the environment influence the function of genes?

  29. Many behaviors… but how many involve gene expression differences? Undertaker (corpse-remover) Comb-builder Forager Guard Nurse Gene clusters (expression level in brain) > 2 1.5 1.25 1 0.8 0.67 < 0.5

  30. Are gene expression changes robust at the level of individual? Can gene expression profile in an individual bee’s brain be used to correctly predict behavioral group?

  31. “Leave-one-out” cross-validated class prediction “Test set” • Method: • Computer identifies a set of “predictor genes” for behavior using expression data from the 59 bees in the “training set.” • Computer attempts to classify the single “test” bee based on its expression of the predictor genes. • Repeat iteratively for all 60 individual bees. • Result: • Computer can correctly assign behavior group for 57 out of the 60 bees. “Training set” 1 bee (computer attempts to classify) 59 bees (computer knows behavior) nurse or forager?

More Related