1 / 29

RNA interference: new tool, ancient immune system Bergen lecture – April 21st 2005

RNA interference: new tool, ancient immune system Bergen lecture – April 21st 2005. Torgeir Holen, CMBN. Aims of this talk. Part I: To give a short introduction to the newly discovered immune system RNA interference (RNAi) in various species.

akasma
Download Presentation

RNA interference: new tool, ancient immune system Bergen lecture – April 21st 2005

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. RNA interference: new tool, ancient immune systemBergen lecture – April 21st 2005 Torgeir Holen, CMBN

  2. Aims of this talk Part I: To give a short introduction to the newly discovered immune system RNA interference (RNAi) in various species Part II: To look at some practical limitations to knocking down mRNA gene expression by RNAi & siRNA, and some recent solutions... Part III: siRNA is already old hat – what’s going on now...? short RNA : DNA/chromatin interactions...

  3. roundworm C. elegans fruitfly Drosophila fungus Neurospora Petunias Transgenic Petunias Transgenic potatoes resist virus infection Part I: Gene silencing exist in many multicellular organisms

  4. Wang, Kumar & Hedges, 1999 Gene silencing go back to the earliest epochs of life on Earth This ancient immune system seems conserved over 1.5 billion years ...thus we can learn about different aspects of gene and RNA silencing wherever it is easiest... plants... roundworms... flies... human cell lines...

  5. 1998: Andrew Fire and colleagues show that double-stranded RNA induce gene silencing in C. elegans A brief history of RNA silencing • 1999: Hamilton & Baulcombe find small RNA where genes are silenced in plants • 2000: Greg Hannon and colleagues isolate Dicer, the siRNA producing RNase-III enzyme in Drosophila • 2001: Thomas Tuschl and colleagues show that synthetic small RNA introduced into human cells can silence human genes

  6. Plasmid produced siRNA • Brummelkamp, 2002; Paddision, 2002;Miyahishi, 2002; Paul, 2002; Sui, 2002; Lee, 2002; Jacque, 2002; Yu, 2002; Yang, 2002

  7. The PRK/interferon response • immune-system virus-response system in mammalian cells • activated by long dsRNA • mechanism: shuts down all translation by by phosphorylating eIF2-alpha (see Williams, Oncogene, 1999) • the siRNA break-through of Thomas Tuschl consisted of the PKR/interferon response not being activated (Elbashir et al, Nature, 2001; also shown by Natasha Caplen, PNAS, 2001)

  8. Part II: Limits to siRNA activity- some other limitations to these great, but very new, tools • siRNA exhibit position effects – some target positions superior to others • siRNA activity fades out – in our case 3-4 days after transfection • siRNA activity can be blocked by competition with less active siRNA • Some siRNA have great tolerance for chemical modifications • Some siRNA tolerate mutations • Main problem of RNAi-field today: delivery, in vitro & in vivo

  9. Fen1, Aqp4 and GlnS Constructs Fusion Reporter Construct ... ... ... ... pTRE pTRE TF (47-951) Fen1/Aqp4/GS LUC (37-2255) LUC (37-2255) pTRE pTRE Finding good target positions: TF-luciferase-reporter assay - Holen et al (Nucleic Acids Research, 2002). - Tissue Factor (TF), is the principal coagulation trigger and has been implicated in cardiac diseases. TF is also involved in angiogenesis and metastasis of cancer.          

  10. hTF562i hTF478i HeLa hTF372i hTF167i PSK314i hTF562i hTF478i 293 hTF372i hTF167i PSK314i hTF562i hTF478i Cos-1 hTF372i hTF167i PSK314i hTF929i hTF562i hTF478i hTF459i hTF372i HaCaT Normalised TF-LUC/RLUC hTF256i hTF167i hTF77i PSK739i PSK566i PSK546i PSK314i 20 40 60 80 100 120 140 Normalised TF-LUC/RLUC Why the position effects? mRNA AGGUGGCCGGCGCUUCAGGCACUACAAAUACUGUGGC hTF158i AGGUGGCCGGCGCUUCAGGTT hTF161i UGGCCGGCGCUUCAGGCACTT hTF164i CCGGCGCUUCAGGCACUACTT hTF167i GCGCUUCAGGCACUACAAATT hTF170i CUUCAGGCACUACAAAUACTT hTF173i CAGGCACUACAAAUACUGUTT hTF176i GCACUACAAAUACUGUGGCTT

  11. PSK739i hTF167i PSK566i hTF372i PSK314i PSK546i hTF562i hTF478i mock TF GAPDH mock hTF158i hTF161i hTF164i hTF167i hTF170i hTF173i hTF176i TF Protein & Coagulation GAPDH Normalised TF expression Northerns Legend: mRNA (filled bars), procoagulant activity (dotted bars) and TF protein (hatched bars) Knock-downs must be verified...- position effect consistent also in Northern assays, protein assays and coagulation assays…

  12. Some recent computational solutions to position effects: • Khvorova, Cell, 2003: 5’-end of active antisense unstable... • Ui-Tei et al, Nucleic Acids Research, 2004: • (i) A/U at the 5' end of the antisense strand • (ii) G/C at the 5' end of the sense strand • (iii) at least five A/U residues in the 5' terminal one-third of the antisense strand • (iv) the absence of any GC stretch of more than 9 nt in length. siRNAs opposite in features with respect to the first three conditions give rise to little or no gene silencing in mammalian cells

  13. Normalised TF/GAPDH mRNA Normalised TF expression Measurements at 4 h, 8 h, 24 h, 48 h RNAi silencing sets in slowly… …why? …and fades out even more slowly, but steadily…

  14. Tolerance for chemical modifications Normalised TF/GAPDH mRNA P1+1 5’-g*c-gcuucaggcacuaca-a-a-u*a-3’ 3’-g*c-c-g-cgaaguccgugaugu-u*u-5’ P0+2 5’-g-c-gcuucaggcacuaca-a-a*u*a-3’ 3’-g*c*c-g-cgaaguccgugaugu-u-u-5’ P2+2 5’-g*c*gcuucaggcacuaca-a-a*u*a-3’ 3’-g*c*c-g-cgaaguccgugaugu*u*u-5’ P2+4 5’-g*c*gcuucaggcacuaca*a*a*u*a-3’ 3’-g*c*c*g*cgaaguccgugaugu*u*u-5’ M1+1 5’-GcgcuucaggcacuacaaauA-3’ 3’-GccgcgaaguccgugauguuU-5’ M0+2 5’-gcgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguuu-5’ M2+2 5’-GCgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguUU-5’ M2+4 5’-GCgcuucaggcacuacaAAUA-3’ 3’-GCCGcgaaguccgugauguUU-5’ A1+1 5’-GcgcuucaggcacuacaaauA-3’ 3’-GccgcgaaguccgugauguuU-5’ A0+2 5’-gcgcuucaggcacuacaaaUA-3’ 3’-GCcgcgaaguccgugauguuu-5’

  15. Inhibition of cholesterol synthesis by siRNA: A recent study by Alnylam Inc • "...Administration of chemically modified siRNAs resulted in silencing of the apoB messenger RNA in liver and jejunum, decreased plasma levels of apoB protein, and reduced total cholesterol. " Soutschek et al, Nature, 2004

  16. An siRNA mutation study **** * ** * * 5'-GCGCUUCAGGCACUACAAAUA GCCGCGAAGUCCGUGAUGUUU-5' Normalised TF/GAPDH mRNA Amarzguioui M, Holen T, Babaie E, Prydz H. Tolerance for mutations and chemical modifications in a siRNA. Nucleic Acids Res. 2003 Jan 15;31(2):589-95.

  17. Other genes possibly targeted by laminB2 CLSTN2 5'-AAGAGGAGGAAGAAGCCGAGG-3' |||||||||| ||||||||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' HS6ST3 5'-AAGAGGAGGAGGAAGACGAGC-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' NM_015897 5'-AAGAGGAGGAGGAAGACGAGG-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' NM_015355 5'-ACUCGGCCUCCUCCUCCUCCU-3' ||||||| ||||||||||| | 3'-UGAGCCGAAGGAGGAGGAGAA-5' ATBF1 5'-AAGAGGAGGAGGAAGACGAGG-3' ||||||||||||||| |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' SPTB 5'-AAGAGGAGGAGGAAACAGAGU-3' |||||||||||||| | |||| 3'-UUCUCCUCCUCCUUCGGCUCA-5' The dangers of siRNA in functional genomics: “…the two other lamins, B1 and B2, are now identified as essential proteins” (Harborth et al, JCS, 2001)

  18. The delivery problem - comparing different transfection agents Lipofectamine2000, Lipofectamine, Oligofectamine and RNAifect…

  19. Day 10 Day 15 mTF223i hTF167i D Day 20 mTF223i mock hTF167i mTF321i mTF GAP mTF223i hTF167i Mohammed Amarzguioui, Qian Peng, Torgeir Holen, Vlada Vasovic, Eshrat Babaie, Jahn M. Nesland & Hans Prydz Indirect delivery in vivo- Tissue Factor in cancer metastasis • set-up: metastatic B16 cells transfected with siRNA against TF, then injected into tail-vein of mice • tumors will then colonize lungs of mouse

  20. RNAi delivery by virus • Lentiviruses delivery especially interesting for delivery to neuronal cells. • An et al, Human Gene Theraphy, 2003 • Stewart et al, RNA, 2003 • Paddison PJ, Silva JM, Conklin DS, Schlabach M, Li M, Aruleba S, Balija V, O'Shaughnessy A, Gnoj L, Scobie K, Chang K, Westbrook T, Cleary M, Sachidanandam R, McCombie WR, Elledge SJ, Hannon GJ. A resource for large-scale RNA-interference-based screens in mammals.Nature. 2004 Mar 25;428(6981):427-31.

  21. Transgenic RNAi: mice expressing siRNA • Carmell, Rosenquist et al, Nature Structural & Molecular Biology, 2003

  22. What of it? Can’t the Cre/LoxP system or other conditional knock-outs do the same? Regulatable knock-downs • From Matsukura et al (Nucleic Acids Research, 2003)

  23. Part III: The possible link between RNA and DNA silencing in higher organisms • RNA silencing, more than siRNA • DNA & chromatin regulation: still unsolved... • Three cases of RNA-DNA silencing link • dsRNA-induced DNA methylation in plants • transgene DNA silencing in Drosophila • centromere silencing in budding yeast (S. pombe) • X-chromatin silencing in humans... • recently: chromatin silencing induced by short RNA in human cells

  24. More small RNA exist • stRNA (short temporal RNA, also called micro-RNA, miRNA) inhibit mRNA translation (Lee & Ambros, 1993; Reinhart, 2000; Lee, 2001; Lau, 2001; Lagos-Quintana, 2001; Llave, 2002; Lim, 2003) • microRNA comes from microGenes, transcripted as ~70 nt hairpins, and processed (as is shRNA) to short ~21-mer RNAs... • latest research hotspot: heterochromatic siRNA might affect centromeres in budding yeast (S.pombe) (Reinhart, 2002; Volpe, 2002)

  25. Double-stranded RNA cause silencing in plants Lehninger, 1993 PTSVd viroids(Wassenegger, Cell, 1994) • PTSVd can lead to methylation of a target down to 30 bp of DNA(Pelissier & Wassenegger, RNA, 2000) HOW???

  26. Lee, Cell, 2000 Lewin, 2000 X-chromosome inactivation centre (Xic) Xic (450 kb region) can be transferred to chromosome 12, resulting in gene silencing, hypoacetylation, histone methylation (His3mLys9), delayed DNA replacation and RNA coating...(Lee & Jaenisch, Nature, 1997)

  27. Summary: What is the mechanism? Allshire, Science, 2002 Is the proposed mechanism right? ...and does it exist in higher organisms? Nobody knows... yet

  28. Two recent papers find chromatin modifications in mammalian cells • Morris KV, Chan SW, Jacobsen SE, Looney DJ. Small interfering RNA-induced transcriptional gene silencing in human cells. Science. 2004 Aug 27;305(5688):1289-92. Epub 2004 Aug 05. • Kawasaki & Taira. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature. 2004 Sep 9;431(7005):211-7. Epub 2004 Aug 15.

More Related