Polymerase Chain Reaction

1. Polymerase Chain Reaction What is PCR History of PCR How PCR works Optimizing PCR Fidelity, errors & cloning PCR primer design Application of PCR

2. What is PCR? • It’s a means of selectively amplifying a particular segment of DNA. • The segment may represent a small part of a large and complex mixture of DNAs: e.g. a specific exon of a human gene. • It can be thought of as a molecular photocopier. Now used for: Cloning Analysis of gene expression SNP detection Mutagenesis

3. The Invention of PCR • Invented by Kary Mullis in 1983. • First published account appeared in 1985. • Awarded Nobel Prize for Chemistry in 1993.

4. Did He Really Invent PCR? • The basic principle of replicating a piece of DNA using two primers had already been described by Gobind Khorana in 1971: – Kleppe et al. (1971) J. Mol. Biol. 56, 341-346. • Progress was limited by primer synthesis and polymerase purification issues. • Mullis properly exploited amplification.

5. A Molecular Photocopier • “The next day was quite a different day. Instead of being hot and sunny, it was cool and misty. Pooh didn’t mind for himself, but when he thought of all the honey the bees wouldn’t be making, a cold misty day always made him feel sorry for them.” A.A. Milne, 1928. A photocopier capable of duplicating a part of a sentence

6. How Powerful is PCR?

7. Gene Analysis Prior to PCR?

8. Heat-stable DNA polymerase • Taq DNA polymerase was isolated from the bacterium Thermus aquaticus. • Taq polymerase is stable at the high temperatures (~95oC) used for denaturing DNA. Hot springs at Yellowstone National Park, Wyoming.

9. Limitations of Taq Polymerase • Error rate for Taq= 1/5000 nucleotides • Does not have 3’ 5’ exonuclease activity for proofreading. • Pfu DNA polymerase can be substituted for Taq polymerase for better proofreading due to 3’ 5’ exonuclease activity. Pfu is slower than Taq and more expensive.

10. Limitations of Taq Polymerase • Pfu gives blunt end PCR products. (Use blunt end cloning strategy). • Taq adds an extra “A” to the 3’ end of PCR products. (Use “T-A” cloning vectors) • Pfu can remove “A overhangs” on Taq PCR products.

11. Components • Heat-stable DNA polymerase (Taq polymerase) • Two Primers (DNA oligonucleotides) • Deoxynucleotides –dATP, dTTP, dCTP, dGTP • DNA template • Mg++, buffer components, and water

12. Primers • Two oligonucleotides of different sequences. • Each are typically 18-25 nucleotides long. (Forward & Reverse) • Primers complementary base pair (“hybridize” or “anneal”) to template DNA. General Example of Primers http://www.bio.davidson.edu/Courses/Molbio/MolStudents/spring2002/Robinson/Isocitrate-main-page.html

13. Lux AB Primers 3’ TACTTCAAACCTTTATAAAC 5’ 5’ CACCATGAAGTTTGGAAATATTTG 3’ (Forward Primer) (Reverse Primer) 3’ TTTTAGCTTTACTTAAATGG 5’ 5’ AAAATCGAAATGAATTTACC 3’ Forward Primer = nucleotides 4230-4249 in template (+ 4 additional nucleotides) Reverse Primer = nucleotides 6290-6310 in template Total length PCR product = 2080 base pairs long

14. Review: Annealing Temperature • The primer annealing temperatures typically range from 55-65oC based on length and G-C content. (Ours are 56oC [Forward] and 47oC [R]) • Annealing temp should be a few degrees below the lowest melting temperature (Tm) for the two primers. (Ours is 48oC) • Tm of two primers should be within 5oC of each other. (Ours are 56oC and 47oC)

15. Tips: Successful Primer Design • 3’ end should have exact homology to the template DNA. • Try to have 50-60% G-C composition. • Avoid complementary base pairing within the primer (“stem-loop” or “hairpins”). • If possible, avoid primer-dimer formation.

16. Hairpin Structure TC C C AGAAGGTGACCAAGTTCAT-3’ TCTTCCA-5’ I I I I I I I CA

17. Primer-Dimers

18. Check Your Knowledge • 3’ GCATTGCTACAT 5’ (Only 12 nucleotides long. Should be at least 18 nucleotides in length) • 3’ GCCGGAGTCTGGCGCGCGCGC ‘5 (Too G-C rich. Will have a high Tm value.) • 3’ GGGGATTCTACCCCACGATATAGCA-5’ (Hairpin formation between GGGG and CCCC. Also, you want to avoid 4 or more G’s or C’s in a row.)

19. Primers • Good primers critical for quality amplifications • Define the target region to be amplified • May be taxon specific • May be universal-widely applicable across taxa • Universality can be achieved through degeneracy, or by sitting on conserved region

20. Characteristics of Good Primers • Should be specific: • Sixteen base sequence will statistically be present only once in every 416 bases (=4294967296, or 4 billion), about equal to the human genome • Should anneal at 50oC or above – a function of length and GC content

21. Primer annealing temperaturesassuming 50-50 AT-GC content

22. Characteristics of Good Primers 3. Should have high specificity on 3’ (extension) end - Often helped by ending primer sequence with GC content 4. Should not include palendromic sequences (will form hairpin loops) 5. Primer annealing temps within 5o C of each other 6. Should not have inter primer homologies - results in primer dimers 7. Between 40-60% GC content 8. No Poly C or G- result in non specific binding • from high bond energy

23. Designing PCR Primers • Primers should be ~20 bases long. • The G/C content should be 45–55%. • The annealing temperatures should be within 1°C of one another. • The 3´-most base should be a G or C. • The primers must not base pair with each other or with themselves or form hairpins. • Primers must avoid repetitive DNA regions.

24. Primers That Form Hairpins • A primer may be self-complementary and be able to fold into a hairpin: 5´-GTTGACTTGATA ||||| T 3´-GAACTCT • The 3´ end of the primer is base-paired, preventing it annealing to the target DNA.

25. Primers That Form Dimers • A primer may form a dimer with itself or with the other primer. 5´-ACCGGTAGCCACGAATTCGT-3´ |||||||||| 3´-TGCTTAAGCACCGATGGCCA-5´ • Primer dimers can be an excellent, but unwanted, substrate for the Taq polymerase.

26. Help With Primer Design • Researchers agreed early on that the design of PCR primers was difficult and unreliable. • Computer programs devised to take all of the design criteria into account. • Primer3 program at the Whitehead Institute is the most reliable and versatile tool currently available.

27. Primers for a COL3A1 variant • The human COL3A1 gene has a variant at amino acid 531 of the triple helix. • Ala or Thr encoded in exon 31 of the gene. • AluI restriction enzyme site present in the Ala allele but absent in the Thr allele. • PCR amplify the region and genotype by digestion of PCR products with AluI.

28. Running Primer3 • Paste the DNA sequence into Primer3 with the “target” enclosed in square brackets. • Select a mispriming library — only human and rodent available at present. • Select option for a 1-base 3´ “GC Clamp”. • Select PCR product size range (>600 bp). • Click the “Pick Primers” button. • Marvel at the ease and simplicity.

29. The COL3A1 Ala/Thr PCR • The PCR primers amplify from the start of exon 31 to just beyond exon 33 — 656 bp. • Ala alleles are digested by AluI, producing fragments of 82 & 574 bp.

30. Will Other Genes Amplify Too? • The primers have been designed on the basis of the DNA sequence of a single gene. • Might the primers also amplify other segments whose sequence we have not taken into account? • Need to consider the sequence of the entire genome to answer this.

31. Virtual PCR Results • Virtual PCR searches entire genome looking for potential primer sites within 10,000 bases of one another. • If found, it performs a virtual PCR reaction. • Primers for Ala/Thr polymorphism in human COL3A1.

32. Components • Heat-stable DNA polymerase (Taq polymerase) • Two Primers (DNA oligonucleotides) • Deoxynucleotides –dATP, dTTP, dCTP, dGTP • DNA template • Mg++, buffer components, and water

33. Deoxynucleic Acids • dATP, dTTP, dGTP and dCTP should be present in equal amounts. • 10X dNTP mix is the least stable component. • Store frozen in small aliquots • Keep dNTP’s on ice!

34. Components • Heat-stable DNA polymerase (Taq polymerase) • Two Primers (DNA oligonucleotides) • Deoxynucleotides –dATP, dTTP, dCTP, dGTP • DNA template • Mg++, buffer components, and water

35. Template DNA • Minimum…50,000 copies/PCR reaction (2 Kb fragment = 0.1 pg) • 1ng-1µg template DNA • Higher concentrations for total genomic • Lower concentrations for plasmid DNA • Use 20ng of lux operon plasmid

36. Template DNA • Always add template DNA last to your reaction vial to avoid contamination. • Always run controls • (+) cloned template (if available) • (-) water only control • (-) vector only control (pGEM) • (-) forward primer control • (-) reverse primer control

37. Components • Heat-stable DNA polymerase (Taq polymerase) • Two Primers (DNA oligonucleotides) • Deoxynucleotides –dATP, dTTP, dCTP, dGTP • DNA template • Mg++, buffer components, and water

38. Mg++, Buffer, and Water • Mg+2 is an essential cofactor for Taq & Pfu DNA polymerase activity. Final [Mg+2] = 1.5mM • 10X PCR buffer=100mM Tris, pH 8.3 + 500mM KCl.

39. Mg++, Buffer, and Water • Water should be ultrapure (MilliQ water) with no salts or DNA contamination. • Template DNA and primers should be resuspended in MilliQ water to avoid high concentrations of EDTA.

40. The Basics of PCR Cycling • 30–35 cycles each • comprising: – denaturation (95°C),30 sec. – annealing (55–60°C), 30 sec. – extension (72°C), • time depends on product size.

41. How does PCR work? One PCR Cycle:

42. One PCR cycle: What the products really looks like… How does PCR work? Template Strand 4 DNA strands Template Strand Biology Animation Library: http://www.dnalc.org/ddnalc/resources/pcr.html

43. Two cycles: What the products really looks like… How does PCR work? 8 DNA strands

44. Three cycles… How does PCR work? 16 DNA strands Notice the production of double stranded, shortened PCR products (target sequence) that spans the two primers. Our target sequences will contain the LUX AB genes.

45. Four cycles… How does PCR work? 32 DNA strands The number of DNA strands doubles after each cycle. Target sequence predominates.

46. How does PCR work? After 30 cycles… Target sequence increases exponentially.

47. What’s in the Reaction? • Template DNA • Reaction buffer (Tris, ammonium ions (and/or potassium ions), magnesium ions, bovine serum albumin) • Nucleotides (dNTPs) • Primers (Forward & Reverse) • DNA polymerase (usually Taq)

48. How many cycles? • Increasing the cycle number above ~35 has little positive effect. • The plateau occurs when: – The reagents are depleted – The products re-anneal – The polymerase is damaged • Unwanted products accumulate.

49. Thermal Cyclers • PCR cyclers available from many suppliers. • Many block formats and multi-block systems. • Reactions in tubes or 96-well micro-titre plates.

50. Has It Worked? • Check a sample by gel electrophoresis. • Is the product the size that you expected? • Is there more than one band? • Is any band the correct size? • May need to optimize the reaction conditions.