1 / 78

Cancer Diagnostics The Old and the New Eleftherios P. Diamandis, M.D., Ph.D., FRCP(C)

Cancer Diagnostics The Old and the New Eleftherios P. Diamandis, M.D., Ph.D., FRCP(C). Course LMP1506S,Thursday,March 7,2002. UNIVERSITY OF TORONTO.

alize
Download Presentation

Cancer Diagnostics The Old and the New Eleftherios P. Diamandis, M.D., Ph.D., FRCP(C)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cancer DiagnosticsThe Old and the NewEleftherios P. Diamandis, M.D., Ph.D., FRCP(C) Course LMP1506S,Thursday,March 7,2002 UNIVERSITY OF TORONTO

  2. Laboratory Medicine and PathologyCompositional analysis of cells, fluids, tissues (proteins, metabolites, DNA, RNA)Information invaluable for patient diagnosis,monitoring, selection of therapy, prognosis,classification

  3. Timeline of Molecular Pathology Lakhani and Ashworth Nature Reviews Cancer 2001;1:151-157

  4. Today’s Laboratory Physician / PathologistMisconception: Pathologists are those who perform autopsies and work in isolation by looking down a microscope all day.Reality: Participate in teams with surgeons, oncologists, radiologists; information provided forms basis for diagnosis and management and for performing new clinical trials(by identifying patient groups).

  5. The Current Pathologist and Cancer Tumor ClassificationEssential for cancer prognosis and selection of treatment:-Carcinoma vs sarcoma vs lymphoma-Primary vs metastatic cancer-Breast carcinoma (ductal vs lobular vs tubular vs mucinous ) -Tumor grade (degree of differentiation)-Tumor stage (size, lymph node involvement plus imaging information)-Surgical margins

  6. The Current Pathologist Cancer Prognosis• Pathologically classified classes of tumors (by stage, grade, histological type) behave differently.• Different responses to therapy: ER, PR (+) breast cancers  Tamoxifen HER2/NEU expression  Herceptin BCR/ABL translocation  Gleevac

  7. Classical Grading System for Breast Cancer

  8. Classical Staging System for Cancer

  9. The Current Laboratory Physician / Scientist / Clinical Pathologist• Tumor marker analysis in serum - screening - diagnosis - prognosis - therapy response - monitoring for relapsePSA,CEA,AFP,hCG,CA125,CA15.3

  10. The ProblemsMorphology:• Subjective analysis - variation between observers• The morphology of the tumor does not always reveal the underlying biology; patients with same tumor type can experience different course of the disease• Immunohistochemistry targets single molecules; biology depends on many

  11. The ProblemsTumor Markers:• No true tumor marker exists (with notable exceptions)• Generally single tumor markers not good for screening/diagnosis (poor sensitivity and specificity)• Very limited role for predicting therapeutic response/prognosis• Useful as aids for monitoring response to therapy

  12. ConclusionsWe need:• better (more objective) and more biologically-relevant tumor classification schemes for prognosis, selection of therapy• better tumor markers for population screening and early diagnosis for cancer prevention

  13. Paradigm Shift (2000 and Beyond)Traditional Method: Study one molecule at a time.New Method: Multiparametric analysis (thousands of molecules at a time).Cancer: Does every cancer have a unique fingerprint? (genomic/proteomic?).

  14. The New Laboratory Physician / Scientist / PathologistChanges seen are driven by recent biological / technological advances: - Human Genome Project - Bioinformatics - Array Analysis - Mass Spectrometry_______________________________________ -Automated DNA Sequencing /PCR: - DNA Arrays - Protein Arrays - Tissue Arrays - Laser Capture Microdissection - SNPs- Comparative Genomic Hybridization

  15. Technological Advances

  16. MicroarraysWhat is a microarray?A microarray is a compact device that contains a large number of well-defined immobilized capture molecules (e.g. synthetic oligos, PCR products, proteins, antibodies) assembled in an addressable format.You can expose an unknown (test) substance on it and then examine where the molecule was captured.You can then derive information on identity and amount of captured molecule.AACC 2001

  17. Principles of DNA Microarrays(Printing oligos by photolithography) Fodor et al.Science 1991;251:767-773)

  18. Microarray TechnologyManufacture or Purchase MicroarrayHybridizeDetectData AnalysisAACC 2001

  19. Applications of Microarrays• Simultaneous study of gene expression patterns of genes• Single nucleotide polymorphism (SNP) detection• Sequences by hybridization / genotyping / mutation detection• Study protein expression (multianalyte assay) • Protein-protein interactionsProvides: Massive parallel information AACC 2001

  20. Microarray Advantages• Small volume deposition (nL)• Minimal wasted reagents• Access many genes / proteins simultaneously• Can be automated• QuantitativeAACC 2001

  21. If Microarrays Are So Good Why Didn’t We Use Them Before?? • Not all genes were available • No SNPs known • No suitable bioinformatics • New proteins now becoming available Microarrays and associated technologies should be regarded as by-products of the Human Genome Initiative and bioinformatics

  22. Limitations of Microarrays • New technology• Technical problems (background;reproducibility)• Need to better define human genes (many ESTs)• Manual• ExpensiveAACC 2001

  23. International Genomics Consortium (IGC)• New initiative• Aims to generate expression data by microarrays• Claims to analyze for all genes 10,000 tumor specimens within 1 year!• All patients will have detailed follow-up informationMolecular Signatures/Portraits of TumorsAACC 2001

  24. Differential Gene Expression(Budding vs Non-Budding Yeast)

  25. Tissue Expression of KLK6 byMicroarray Highest Expression brain,spinal cord,then salivary gland,spleen,kidney MedianX10 Cell Line or Tissue

  26. Tissue Expression Profiles• Many proprietary databases - created by microarray analysis• Can search as follows:* which genes are expressed in which tissues (tissue specific expression)* unique genes expressed only in one tissue* quantitative relationships between levels of expression* expression is normal vs diseased tissueLimitations: - RNA data; not protein- great variability in resultsAACC 2001

  27. Lung Tumor: Up-Regulated

  28. Lung Tumor: Down-Regulated

  29. Whole Genome Biology With Microarrays Cell cycle in yeast Study of all yeast genes simultaneously! Red;High expression Blue:Low expression Lockhart and Winzeler Nature 2000;405:827-836

  30. Microarray Imaging of Tissue Sections Clinical CareDiagnosis PrognosisPrediction of therapeutic responseMonitoring Research Understanding Disease Pathogenesis

  31. Comparative Genomic Hybridization• A method of comparing differences in DNA copy number between tests (e.g. tumor) and reference samples• Can use paraffin-embedded tissues• Good method for identifying gene amplifications or deletions by scanning the whole genome.

  32. Comparative Genomic Hybridization Cot1DNA blocks repeats) Label with Cy-5 Label with Cy-3 Nature Reviews Cancer 2001;1:151-157

  33. Laser Capture MicrodissectionAn inverted microscope with a low intensity laser that allows the precise capture of single or defined cell groups from frozen or paraffin-embedded histological sectionsAllows working with well-defined clinical material.

  34. Tumor Heterogeneity(Prostate Cancer) Tumor Cells, Red Benign Glands,Blue Rubin MA J Pathol 2001;195;80-86

  35. Laser Capture Microdissection LCM uses a laser beam and a special thermoplastic polymer transfer cup(A).The cap is set on the surface of the tissue and a laser pulse is sent through the transparent cap,expanding the thermoplastic polymer. The selected cells are now adherent to the transfer cap and can be lifted off the tissue and placed directly onto an eppendorf tube for extraction(B). Rubin MA,J Pathol 2001;195:80-86

  36. Tissue Microarrays• Printing on a slide tiny amounts of tissue• Array many patients in one slide (e.g. 500)• Process all at once (e.g. immuno- histochemistry)• Works with archival tissue (paraffin blocks)AACC 2001

  37. Gene Expression Analysis of Tumors cDNA Microarray Lakhani and Ashworth Nature Reviews Cancer 2001;1:151-157

  38. Tissue Microarray Alizadeh et al J Pathol 2001;195:41-52

  39. H&E HK6 Histochemical staining of microarray tissue cores of ovarian serous adenocarcinoma. -tjc -Identical microscopic fields showing variable staining intensity of various tissue cores for HK6 (right)

  40. H&E HK6 Histochemical staining of a microarray tissue core of ovarian clear cell adenocarcinoma. -tjc-Identical microscopic fields showing strong cytoplasmic positivity for HK6 within carcinoma (and endothelium, lower right)

  41. H&E HK6 Histochemical staining of a microarray tissue core of ovarian serous adenocarcinoma. -tjc-Note: Cytoplasmic positivity for HK6 in carcinoma, endothelium and stromal cells.

  42. Molecular Profiling of Prostate Cancer Rubin MA, J Pathol 2001;195:80-86

  43. Single Nucleotide Polymorphisms (SNP)• DNA variation at one base pair level; found at a frequency of 1 SNP per 1,000 - 2,000 bases• Currently, a map of 1.42 x 106 SNPs have been described in humans (Nature 2001; 409:928-933) by the International SNP map working group)• Identification: Mainly a by-product of human genome sequencing at a depth of x10 and overlapping clones• 60,000 SNPs fall within exons; the rest are in intronsAACC 2001

  44. Why Are SNPs Useful?• Human genetic diversity depends on SNPs between individuals (these are our genetic differences!)• Specific combinations of alleles (called “TheHaplotype”) seem to play a major role in our genetic diversity• How does thisgenotype affect thephenotypeDisease predisposition?Continued:…….. AACC 2001

  45. Why are SNPs useful………………..continued:Diagnostic ApplicationDetermine somebody’s haplotype (sets of SNPs) and assess disease risk.Be careful: These disease-related haplotypes are not as yet known!AACC 2001

  46. TTAGCTAGTCTGGACATTAGCCATGCGGAT TTAGCTAGTCTGGACATTAGCCATGCGGAT GACCTGTAATCG GACCTATAATCG Genotyping: SNP Microarray • Immobilized allele specific oligo probes • Hybridize with labeled PCR product • Assay multiple SNPs on a single array

  47. High- Throughput Proteomic Analysis By Mass Spectrometry Haab et al Genome Biology 2000;1:1-22

  48. Applications of Protein Microarrays • Screening for- • Small molecule targets • Post-translational modifications • Protein-protein interactions • Protein-DNA interactions • Enzyme assays • Epitope mapping

  49. MIX Detection system IL-1  IL-6 IL-10 VEGF BIOTINYLATED MAB ANTIGEN CAPTURE MAB marker protein cytokine Cytokine Specific Microarray ELISA

  50. Recently PublishedExamples

More Related