Support : NIEHS U01 ES11038 Mouse Centers Genomics Consortium

1. Individuals (33 patients + 12 controls) Individual: Cincinnati Comparative Mouse Genomics Centers Consortium: Bioinformatics Analysis Tools for Assessment of Human Gene Polymorphisms Anil G Jegga, Sivakumar Gowrisankar, Jing Chen, Rafal Adamczak, Ashima Gupta, Marc A Ramirez, Kalyan SC Andra, James W Carman, Bruce J Aronow University of Cincinnati and Cincinnati Children’s Hospital Medical Center, Cincinnati, OH-45229 Poly-Articular JRA Course 1087PB, Poly, 2_Poly , MTX 1 , XR_space narrowing 1073, Syst, 2_Poly , MTX 0 , XR_space narrowing 872, Poly, 2_Poly , MTX 1 , XR_space narrowing 11113.3, Pauci, 1_Pauci , MTX 0 , XR_unknown 845, Spond, JAS , MTX 0 , XR_space narrowing 1081, Poly, 2_Poly , MTX 0 , XR_space narrowing 817, Pauci, 1_Pauci , MTX 0 , XR_space narrowing 9245, Spond, JSPA , MTX 0 , XR_space narrowing 7177, Spond, JSPA , MTX 1 , XR_space narrowing Controls 9137, Poly, 2_Poly , MTX 0 , XR_space narrowing 878, Pauci, 2_Poly , MTX 1 , XR_erosions 801, Pauci, 2_Poly , MTX 1 , XR_erosions 850, Poly, 2_Poly , MTX 1 , XR_erosions 993, Syst, 2_Poly , MTX 1 , XR_space narrowing 831, Poly, 2_Poly , MTX 1 , XR_erosions 9272, Poly, 2_Poly , MTX 1 , XR_unknown 912, Syst, 2_Poly , MTX 1 , XR_space narrowing 19, Pauci, 2_Poly , MTX 1 , XR_space narrowing 1085, Control, na , MTX 0 , XR_na 1089, Control, na , MTX 0 , XR_na 1082, Control, na , MTX 0 , XR_na 7108, Syst, 3_Systemic , MTX 1 , XR_normal 8003, Pauci, 1_Pauci , MTX 0 , XR_unknown 7206, Pauci, 1_Pauci , MTX 0 , XR_unknown 1095, Control, na , MTX 0 , XR_na 9264, Pauci, 1_Pauci , MTX 0 , XR_erosions 7149.3, Control, na , MTX 0 , XR_na 18042, Spond, JAS , MTX 0 , XR_sclerosis 9161, Pauci, 1_Pauci , MTX 1 , XR_normal 7145, Pauci, 1_Pauci , MTX 0 , XR_normal 9150, Spond, JAS , MTX 0 , XR_sclerosis 976, Pauci, 1_Pauci , MTX 1 , XR_normal 18036, Pauci, 1_Pauci , MTX 0 , XR_normal 894, Pauci, 2_Poly , MTX 1 , XR_normal 18057, Spond, JAS , MTX 0 , XR_sclerosis 7029, Pauci, 1_Pauci , MTX 0 , XR_normal 824, Poly, 2_Poly , MTX 0 , XR_normal 1087ctrl, Control, na , MTX 0 , XR_na 7021.31, Control, na , MTX 0 , XR_na 7118.3, Control, na , MTX 0 , XR_na 7113.3, Control, na , MTX 0 , XR_na 813.3, Control, na , MTX 0 , XR_na 1083, Control, na , MTX 0 , XR_na 1084, Control, na , MTX 0 , XR_na 105 Genes with Significantly Lower Expression In PolyArticular JRA Molecular Entities & Relationships Genomic Sequence with Exons (red) 242 genes % sequence identity Regions of sequence similarity between human and mouse conserved Cis-element density between human and mouse Molecular Databases Processes & Associated Databases 137 Genes with Significantly Higher Expression In PolyArticular JRA PathMaker Application Layers Display Layer PathMaker Canvas and Navigator Pathway Biomaterial Process Molecule Organization and Modification Layer Biomaterial Process_In Process_out Molecule_in Molecule_out Action bind dissociate activate inhibit convert Gene feature promoter cis-element product transcript splice form protein domain polymorphism snp ins / del Chromosome structure damage state Chemical structure reaction Molecular Complex composition modification state Physiological gene ontology molecular function biological process cellular localization Temporal Pathologic Toxicologic Injury Genomic damage SNOMED pathology ICD-9/10 OMIM Exposure Xenobiotic Microbiologic Pharmacologic Biologic Clinical Outcome Taxon Developmental Temporal Anatomic body part organ tissue cell subcellular PubMed OMIM GenBank Swiss-Prot KEGG Ensembl Taxonomy Ontology Complex Ontology State Changer Model Viewer Viewer Categorizer Builder Browser Search and Browse General Molecule Ontology Search Search Explorer Generalized Biological Object Model Pathways Processes & Diseases Biological Ontologies PathMaker uses ontologies of specific biological domain knowledge to model the effects of environment, genetic variation, and therapy on oncogenic molecular pathways and disease processes. TraFaC: To identify gene features potentially susceptible to the effects of polymorphisms, we have developed a system that uses mouse-human comparative genomic sequence feature analysis to identify conserved cis-element clusters that could act as gene regulatory regions. Our current implementation of this tool has focused on the identification and characterization of genomic features that are conserved between mouse and human (http://trafac.chmcc.org). Additional functionalities under development will allow for direct visualization of conserved features altered by insertions, deletions, and non-coding SNPs. Clinical/Experimental-GeneChip DataSet Questions: what are the relevant patterns for disease/biology? EGP genes (234): Incidence of SNPs in the context of functional domains PATHMAKER: A systems biology modeling and data mining tool built on a generalized biological object model able to represent the interaction of genes, biologic processes, environment, oncogenic pathways, and disease. >Seq 2 Genomic GACTGAGGGCTTGTGAAACAGCAAGAACCTGTCTCAAAAAACAGTGGGCAGGGAGGGGATTAATGAATAGGCAGCTACGTTCTGGGACTGGAGGGACTCGAGGTGGCTAGAAAGCAAGAGGTACTGGGAGACAAGGCTGCAGACATTTCTTTTTTTTTTTTTTTTTTTTGAGACAGAGTC >Seq 1 Genomic AGAGAAAATTGCTAGAGCTCAGGAGTTTGAGACCAGCCTGGGCAATAGAGTAAGACTTTGTCTCTATCAAAAATTTAAAAATTAACTGGGCTTGGCGGTGTGCACCTGTGGTCCAGCTACTCAGGAGGCTGAGGTGGGAGGATTGCTTGAGCCCAAGAGGTTGAGGCTGCAGTAAGCCGT BlastZ Local Alignment Number 5 Similarity Score: 3074 Match Percentage: 51 % Number of Matches: 96 Number of Mismatches: 39 Total Length of Gaps: 52 Begins at (8281,8874) and Ends at (8416,9059) Seq 1 <--> Seq 2 Sim% No. of Nt 8281-8300 <--> 8874-8893 70% (20 nt) 8301-8310 <--> 8902-8911 90% (10 nt) 8311-8324 <--> 8923-8936 57% (14 nt) 8325-8376 <--> 8947-8998 62% (52 nt) 8378-8386 <--> 8999-9007 67% (9 nt) 8387-8416 <--> 9030-9059 90% (30 nt) TF Binding Sites TF Binding Sites TraFaC Seq 1 <--> Seq 2 Sim% Nt Hits 8301-8310 <--> 8902-8911 90% (10 nt) 3 8311-8324 <--> 8923-8936 57% (14 nt) 2 8325-8376 <--> 8947-8998 62% (52 nt) 3 8378-8386 <--> 8999-9007 67% (9 nt) 0 8387-8416 <--> 9030-9059 90% (30 nt) 4 * CMGCC-UC BIOINFORMATICS TOOLS PathMaker PolyDoms (http://polydoms.cchmc.org) PathMaker: To represent the presence and impact polymorphisms in the context of biological pathways, we have sought to unify our representation of molecular, biological, and environmental entities such that biological knowledge from experts and biomedical literature could be assembled in a storyboard canvas. For example, the representation of a disease could consist of a biological process that is itself comprised of one or more pathways, within which, entities (gene products, complexes, and cellular and sub-cellular components) are subjected to one or more interactions and transitions to disease term associated states. We have begun the development of an application and database structure that can represent these processes, using a host of publicly available data sources including gene objects and biological ontologies to represent biomedical literature and expert knowledge. PolyDoms: We have now mapped all non-synonymous SNPs of EGP genes onto the corresponding conserved and known functional protein domains. The potential protein structure altering implications of the coding SNPs have been collected into a general visualizer for the polymorphic proteins (http://polydoms.cchmc.org) using the PolyPhen (Polymorphism Phenotyping; http://tux.embl-heidelberg.de/ramensky/) annotations and SIFT (Sorting Intolerant From Tolerant; http://blocks.fhcrc.org/~pauline/SIFT.html) server. Links to MedLine abstracts referring to the disease implications of any polymorphism of each protein is also provided when available, and are automatically updated for each of the proteins. We are also extending the mapping of the nsSNPs in the context of the 3D structure. Human RefSeq Proteins A principal goal of the NIEHS Comparative Mouse Genome Centers Consortium (CMGCC) is to systematically evaluate the effect of human genome polymorphisms on critical genes, pathways, and processes that alter the impact of environmental agents on human disease. The evaluation process is to identify polymorphisms, perform sequence analysis, and assess disease association and functional impact using mouse models. Sequence analysis provides an opportunity to prioritize the functional evaluation process in favor of polymorphisms likely to have harmful impact. The University of Cincinnati – CCMGC (Cincinnati Comparative Mouse Genomics Center; http://cmgcc.cchmc.org) has developed several bioinformatics’ analysis tools to improve visualization, assessment, and ranking of polymorphisms. We are now collaborating with the Universities of Washington and Utah and have developed methods to study all of the genes within the EGP and have focused analyses and tools development in three areas: genes, proteins, and pathways. In particular, we have analyzed most of the genes within DNA repair and cell cycle control categories. Pfam Domain Database Domain Mapping EGP-SNPs NCBI-dbSNP (non-EGP Genes) • Biological Implication • Text Parsing • PolyPhen/SIFT PolyDom TraFaC (http://trafac.cchmc.org) Human-Mouse Comparative Genomics Analysis of OGG1 for Coding and Non-Coding Regulatory Region Conservation conserved cis-elements in 2nd intron of Ogg1 OGG1: Mapping Non-Synonymous SNPs onto Conserved Protein Domains & 3D Structure Ala 288 Val Asp 322Asn Arg 229 Gln Protein domain-pfam00730, HhH-GPD superfamily base excision DNA repair protein OGG1 Peptide Sequence 345 aa * Disease Implication Esophageal cancer (Xing et al 2001) Lung cancer (Sugimura et al 1999) Prostate cancer (Xu et al 2002) Stomach cancer (Hanaoka et al 2001) Support: NIEHS U01 ES11038 Mouse Centers Genomics Consortium