1 / 33

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species.

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA Brian Kreiser University of Southern Mississippi. OR. Where Are You From & Who’s Your Daddy. ?. A Brief Introduction.

althea
Download Presentation

Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Developing Microsatellite Loci for Alligator Gar and Their Usefulness in Other Gar Species. Greg Moyer U.S. Fish and Wildlife Service - Warm Springs, GA Brian Kreiser University of Southern Mississippi

  2. OR Where Are You From & Who’s Your Daddy ?

  3. A Brief Introduction Kreiser & Colleagues Moyer & Colleagues Kevin Feldheim - The Field Museum Wilfredo Matamoros - USM Jake Schaefer - USM Brian Sloss – USGS Josh Rousey – Valdosta State Justin Sipiorski - SIU

  4. Samples in Hand MS Gulf Coast Fishing Rodeo (2002+) - Dennis Riecke (MDWFP) St. Catherine Creek NWR - Ricky Campbell (UWFWS) Vicksburg - Jan Hoover (Army Corp) Oklahoma - Kerry Graves (USFWS) Louisiana - Allyse Ferrara (Nichols State U.) Texas - Mark Malfa (bowfishing guide) Choctawhatchee - Frank Parauka (USFWS) Other gar species (spotted, longnose, shortnose, Florida)

  5. Overview • Background on conservation genetics, molecular tools and microsatellites • Summary of work to date • Future directions - your input

  6. Conservation Genetics Fields of - Ecology, Population Genetics & Systematics Tools of - Molecular Biology & Mathematical Modeling

  7. Overlapping Questions

  8. What is genetic variation and why is it important? • All the variation due to differences in alleles and genes in an individual, population, or species • Raw material for adaptive evolutionary change • Genetic diversity is required for populations to evolve in response to environmental changes1 • Heterozygosity levels are linked directly to reduced population fitness via inbreeding depression2 1McNeely et al. 1990; 2Reed and Frankam 2003

  9. What is genetic variation and why is it important? • Conservation plans • maintain self sustaining populations • . . . long-term viable populations • What does viability and self-sustaining actually mean? • A viable population must be large enough to maintain sufficient genetic variation for adaptation to environmental changes

  10. The Molecular Markers Species Boundaries Population Structure Within Populations Mitochondrial DNA Microsatellites

  11. Screening for Genetic Variation Microsatellite gel run

  12. Not Really That Complicated Not the Kreiser Lab Kreiser Lab

  13. Why Mitochondria? “Powerhouse of the cell”; with its own genome Small, circular genome High mutation rate Variation for population studies Clonal Maternal inheritance

  14. Microsatellites - DNA Fingerprinting Many loci in genome Highly polymorphic

  15. Microsatellites - DNA Fingerprinting Example: - (CA) repeat - 6 alleles #8 Genotype = 144 bp / 156 bp - six repeat units difference #2 Genotype = 148 bp / 146 bp - one repeat unit difference #5 Genotype = same

  16. Microsatellites - DNA Fingerprinting Multilocus genotype = the DNA fingerprint Individual Locus 1Locus 2Locus 3Locus 4 #2 148/146160/156220/212138/130 #5 148/146158/156218/210140/136 #8 144/156160/158224/220142/132

  17. Microsatellite Marker Development • Collaborative effort among agencies, universities and laboratories • Goal • Develop a suite of 12-16 markers for estimating population genetic parameters

  18. Microsatellites - Isolating Loci DNA Extraction Enrichment (GCC) (AT) (GATA) Clone Select Loci Bearing Clones Sequence Clones

  19. Microsatellites - Isolating Loci Atsp 84 - primer design TATTCCAAGGTGCAGCTGTAAGAATGCCATACAAACAAACAAACAAACAAACAAAC AAACAAACAAACAAACAAACAACTCACTCTTCTGAGCTAAAATTCTGTGCTGTCTGTT TTGGGTGAAAACTAGGGAGTTTGCAGAACTCTTTGAGAGTTTTTTTAAGGTGCACATAA AAACTTCATCAGGATCTGAAACACCGTCACTGTGCTGGCTTCCCATTAACCAATATCTG TTTCCTC Atsp 159 4 alleles 16 alleles Atsp 12 1 allele

  20. Results • Moyer lab (lots of work and nothing to show for it!) • Two libraries constructed (enriched for di and tri repeats) • 24 primers sets developed and optimized • 14 of 24 loci -- successful and consistent amplification of alligator gar DNA • Limited variation • 5 loci limited to 1 allele • 7 loci had 2 alleles • 2 loci had 3 alleles • Cross species amplification with L. osseus, oculatus, platostomus, tropicus, and platyrhincus • Similar results

  21. Results Kreiser lab - Alligator gar 19 individuals - MS Gulf Coast fishing rodeo 30 loci tested 14 - not resolved 16 - amplified 5 - monomorphic (one allele) 11 - polymorphic (no deviation from HWE or LD)

  22. Loci Testing

  23. Loci Testing Other gar L. oculatus (n=14) & L. osseus (n=13)- Pascagoula 30 loci tested 12-13 - not resolved 7-8 - amplified 2-4 - monomorphic 4-5 - polymorphic (no deviation from HWE or LD)

  24. Loci Testing

  25. Where do we go from here?

  26. Restoration Goals • Ecological • Supplement existing populations • Establish new populations • Ecological functions • Genetic • Maintain/restore adaptive diversity and evolutionary processes to promote population persistence. • Adaptive genetic variation within populations • Genetic structure among populations • Historical • Restore the past? • Ensure the future?

  27. Strategies for ecological restoration • Wait and see • Restore habitat • Goal is simply to enhance natural recruitment • No intended or unintentional genetic impact • Hatchery-based enhancement • Goal is to increase numbers • No intentional genetic impacts • Unintentional impacts depending on the source of brood stock, how it’s managed, and the natural genetic structure • Genetic Rehabilitation • Goal is to “improve” the genetics of populations • Manipulate gene flow • Selectively bred or genetically engineered brood stock

  28. Conservation Genetics & Hatchery Propagation • Best choice is local brood stock • Non local • Risk – outbreeding depression (relative fitness of hybrids and back crosses < natural population) • Does genetic similarity = adaptive similarity? • Can have high gene flow but local adaptation • Recommendation • Avoid non-local brood stock • Test for adaptive vs. neutral genetic variation

  29. Conservation Genetics & Hatchery Propagation • Local brood stock • Genetic diversity • Hatchery ≈ natural • Risk: inbreeding depression • Lower relative fitness of hatchery stock • Recommendation – Genetic baseline data • Large number of unrelated founders – number depends on generation time of organism • Spawn unrelated • Avoid spawning brood stock more than once • Use brood held in captivity < 1 generation1 • Equalize parent contributions • Rearing conditions • Hatchery ≈ natural • Risk: artificial selection • Lower relative fitness of hatchery stock • Recommendation • Equalize parent contributions 1Araki et al. 2007 Science

  30. Questions/Suggestions?

More Related