1 / 3

IrVd

GGGAGCCCCGGGGAAAC, Tm = 68,77, G+C = 76,47 GGGAGCCCCGGGGCAAC, Tm = 72,04, G+C = 82,35 GGGATCCCCGGGGAAAC, Tm = 65,54, G+C = 70,59 GGGATCCCCGGGGCAAC, Tm = 68,85, G+C = 76,47 Tm range = 65,54 - 72,04 GC range = 70,59-82,35 Fold degeneracy = 4 Length = 17. Pospi1Deg-FW. 16 séquences.

alton
Download Presentation

IrVd

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. GGGAGCCCCGGGGAAAC, Tm = 68,77, G+C = 76,47 GGGAGCCCCGGGGCAAC, Tm = 72,04, G+C = 82,35 GGGATCCCCGGGGAAAC, Tm = 65,54, G+C = 70,59 GGGATCCCCGGGGCAAC, Tm = 68,85, G+C = 76,47 Tm range = 65,54-72,04 GC range = 70,59-82,35 Folddegeneracy = 4 Length = 17 Pospi1Deg-FW 16 séquences TCDVd 248 séquences PSTVd IrVd 14 séquences TPMVd 78 séquences CLVd 37 séquences PCFVd 78 séquences CSVd 222 séquences CEVd TASVd 24 séquences 6 séquences

  2. AGCTTCAGTTGTATCCACCGGGT, Tm = 69,86, G+C = 52,17 AGCTTCAGTTGTTTCCACCGGGT, Tm = 70,77, G+C = 52,17 Tm range = 69,86-70,77 GC range = 52,17-52,17 Folddegeneracy = 2 Length = 23 Pospi-RE Complément réverse 16 séquences TCDVd 247 séquences PSTVd IrVd 14 séquences TPMVd CLVd 37 séquences PCFVd 76 séquences CSVd 222 séquences CEVd TASVd 24 séquences 6 séquences

  3. Length: 22 delta H: -175,10 Kcal/mol delta S: -473,01 eu delta S (standard -- 1M NaCl): -464,90 eu delta G, 37cal/mol-28,32 Kcal/mol delta G, 37 S (standard -- 1M NaCl): -30,83 Kcal/mol Primer 1 G+C: 68,18% Primer 2 G+C: 68,18% Tm: 72,87°C PCLV4 Complément réverse CLVd

More Related