1 / 4

Q1: The process of making RNA using a DNA template is called: Transformation Translation

Q1: The process of making RNA using a DNA template is called: Transformation Translation Transposition Transcription Transduction. Q2: The process of making protein using an RNA template is called: Transformation Translation Transposition Transcription Transduction.

amena
Download Presentation

Q1: The process of making RNA using a DNA template is called: Transformation Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Q1: The process of making RNA using a DNA template is called: Transformation Translation Transposition Transcription Transduction

  2. Q2: The process of making protein using an RNA template is called: Transformation Translation Transposition Transcription Transduction

  3. Q3: Consider the following segment of DNA, where the bases in bold are a promoter. Transcription initiates at the position indicated by underlined base pair and terminates at the boxed base pair. 5’ …CAAACGTCTAGTGATGCATGGTATCATAAGGAGGCTGATGTACAAGCATTGACCGT… 3’ 3’ …GTTTGCAGATCACTACGTACCATAGTATTCCTCCGACTACATGTTCGTAACTGGCA… 5’ | | | | | 1 10 20 30 40 What RNA molecule(s) is produced when RNA polymerase makes a transcript(s) from this promoter? A) 5’ CAAACGUCUAGUGAUGCAUGGUAUCAUAAGGAGGCUGAUGUACAAGCAUUGACCG 3’ B) 5’ AUAAGGAGGCUGAUGUACAAGCAUUGACCG 3’ C) 5’ UAUUCCUCCGACUACAUGUUCGUAACUGGC 3’ 3’ GUUUGCAGAUCACUACGUACCAUAGU 5’ D) E) All of the above

  4. Q4: Consider the following mRNA: 5’ AUA AGG AGG CUG AUG UAC AAG CAU UGA CCG 3’ What amino acid sequence could be made from this mRNA? A) C-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-Pro-N B) C-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-N C) N-Ile-Arg-Arg-Leu-Met-Tyr-Lys-His-C D) C-Met-Tyr-Lys-His-N E) N-Met-Tyr-Lys-His-C

More Related