1 / 18

Genetics Unit – Lesson 8: Genetic Disorders & Mutation

Genetics Unit – Lesson 8: Genetic Disorders & Mutation. Course: Monarch Park Grade IB Biology (SBI-4IB) Teacher: Ms. Founk Email: monarchpark.sbi4ib@gmail.com. Human maladies. Measles. Cholera. Chicken pox. Melanoma. Alzheimers. Stroke. Tuberculosis. STDs. Heart disease.

anitra
Download Presentation

Genetics Unit – Lesson 8: Genetic Disorders & Mutation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genetics Unit – Lesson 8: Genetic Disorders & Mutation Course: Monarch Park Grade IB Biology (SBI-4IB) Teacher: Ms. Founk Email: monarchpark.sbi4ib@gmail.com

  2. Human maladies Measles Cholera Chicken pox Melanoma Alzheimers Stroke Tuberculosis STDs Heart disease Huntington’s disease Sickle cell anemia Autism Cold/Flu Parkinson’s disease Crohn’s Scurvy Malaria HIV/AIDS Lung cancer Lou Gehrig’s Disease/ALS Kidney stones Down syndrome Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  3. Do you make more errors than a cell? Errors during meiosis: Non-disjunction Meiosis is a process that uses cellular division to produce the sex cells or gametes that are used for reproduction. During meiosis, the cell identifies chromosome pairs and sorts them to opposite sides of the cell. Sometimes, errors occur during this sorting process resulting in extra or missing chromosomes. • INSTRUCTIONS • Cut out chromosomes pairs • Mix the shapes in a pile on your desk. Imagine that this represents the nucleus of a cell • When instructed, sort the 23 chromosome pairs as fast as you can so that 1 copy of each chromosome is on either side of your desk. • You will have 1 minute to sort. • After 1 min, record the number of pairs you were able to successfully sort Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  4. Detecting chromosome abnormalities Karyotyping Chromosomes are sorted according to several characteristics: • Chromosome length • Chromosome structure • Banding pattern • Position of centromere Karyotypes are used to assess the sex of a person • The X chromosome is much larger than the Y chromosome • XX = female • XY = male Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  5. Detecting chromosome abnormalities Karyotyping Varying numbers of sex chromosomes lead to a variety of different disorders TRIPLE X (XXX = female) TURNER SYNDROME (XO = female) Watch this talk: http://www.ted.com/talks/lang/en/alice_dreger_is_anatomy_destiny.html KLINEFELTER SYNDROME (XXY = male) Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  6. Detecting chromosome abnormalities Karyotyping Varying numbers of autosomeslead to a variety of different disorders Look up Look up DOWN SYNDROME (Trisomy 21) Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  7. Do you make more errors than a cell? Errors during DNA replication: Point mutations DNA replication occurs before mitosis and meiosis so that a new copy of DNA is created. The cell is very good at copying the 3 billion base pairs of DNA present in every human cell, but sometimes it makes mistakes. Sequence: ATCCGACGTTTGCGATCGATCGATGGGGTCGATAAAAGCT Copy of Sequence: ____________________________________________ Number of mistakes: _______________________ Complementary Sequence: ____________________________________________ Number of mistakes: _______________________ Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  8. Point mutations are single nucleotide changes in the DNA Point mutations can have varying effects within the cell e.g. Transcribe and translate the following sense strand: TTA TAT CTC GTA UUA UAU CUC GUA Leu Met Leu Val TTA TAA CTC GTA TTA TTA TCT CGT A TTA TAT ATC GTA TTA TAT CTT GTA UUA UUA UCU CGU A UUA UAA CUC GUA UUA UAU CUU GUA UUA UAU AUC GUA LeuLeu Ser Ala LeuStop Leu Met LeuVal Leu Met Ile Val Missense mutation Silent mutation Nonsense mutation Frameshift mutation Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  9. A Case Study: Sickle Cell Anemia Transcribe and translate a section of the genome that encodes for hemoglobin (Hb) sense sense CCU GUG GAG CCU GAG GAG Pro Val Glu Pro GluGlu Glutamic acid Valine Sickle cell anemia Normal blood cell Changing a single nucleotide changes the mRNA sequence which changes the codonwhich changes the amino acid. Glutamic acid and valine have very different chemical and physical properties which affects the ability of the hemoglobin to form proper quaternary structure resulting in sickle looking cells that have decreased ability to carry oxygen in the blood. Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  10. Repair pathways within the cell SIDE NOTE: The cell has proteins that work to repair DNA • BRCA1 – gene linked to breast cancer • Repairs cell from double strand breaks • Repair proteins can be identified using DNA damage foci • BLAST tool from NCBI can be used to align sequences and detect sequence differences Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  11. Genetics Unit – Lesson 8: Genetic Disorders & Mutation Course: Monarch Park Grade IB Biology (SBI-4IB) Teacher: Ms. Founk Email: monarchpark.sbi4ib@gmail.com

  12. Do you make more errors than a cell? Errors during meiosis: Non-disjunction Meiosis is a process that uses cellular division to produce the sex cells or gametes that are used for reproduction. During meiosis, the cell identifies chromosome pairs and sorts them to opposite sides of the cell. Sometimes, errors occur during this sorting process resulting in extra or missing chromosomes. • INSTRUCTIONS • Cut out chromosomes pairs • Mix the shapes in a pile on your desk. Imagine that this represents the nucleus of a cell • When instructed, sort the 23 chromosome pairs as fast as you can so that 1 copy of each chromosome is on either side of your desk. • You will have 1 minute to sort. • After 1 min, record the number of pairs you were able to successfully sort Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  13. Detecting chromosome abnormalities Karyotyping Chromosomes are sorted according to several characteristics: • Chromosome _________ • Chromosome _________ • ________________ • ________________ Karyotypes are used to assess the sex of a person • The X chromosome is much _______than the Y chromosome • XX = ____________ • XY = ____________ Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  14. Detecting chromosome abnormalities Karyotyping Varying numbers of ________________ lead to a variety of different disorders Watch this talk: http://www.ted.com/talks/lang/en/alice_dreger_is_anatomy_destiny.html Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  15. Detecting chromosome abnormalities Karyotyping Varying numbers of _____________ lead to a variety of different disorders Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  16. Do you make more errors than a cell? Errors during DNA replication: Point mutations DNA replication occurs before mitosis and meiosis so that a new copy of DNA is created. The cell is very good at copying the 3 billion base pairs of DNA present in every human cell, but sometimes it makes mistakes. Sequence: ATCCGACGTTTGCGATCGATCGATGGGGTCGATAAAAGCT Copy of Sequence: ____________________________________________ Number of mistakes: _______________________ Complementary Sequence: ____________________________________________ Number of mistakes: _______________________ Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  17. Point mutations are single nucleotide changes in the DNA Point mutations can have varying effects within the cell e.g. Transcribe and translate the following sense strand: TTA TAT CTC GTA UUA UAU CUC GUA Leu Met Leu Val TTA TAA CTC GTA TTA TTA TCT CGT A TTA TAT ATC GTA TTA TAT CTT GTA UUA UUA UCU CGU A UUA UAA CUC GUA UUA UAU CUU GUA UUA UAU AUC GUA LeuLeu Ser Ala LeuStop Leu Met LeuVal Leu Met Ile Val Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

  18. A Case Study: Sickle Cell Anemia Transcribe and translate a section of the genome that encodes for _______________ sense sense Glutamic acid Valine ______________ ______________ Changing a single nucleotide changes the mRNA sequence which changes the codonwhich changes the amino acid. Glutamic acid and valine have very different chemical and physical properties which affects the ability of the hemoglobin to form proper quaternary structure resulting in sickle looking cells that have decreased ability to carry oxygen in the blood. Monarch Park SBI-4IB – Genetics Unit – Lesson 8: Genetic Disorders & Mutants

More Related