Towards DNA sequencing by force

1. Towards DNA sequencing by force Josep Maria Huguet, Núria Forns, Fèlix Ritort Small Biosystems Lab, Facultat de Física, UB http://www.ffn.ub.es/ritort/ Steve B. Smith, Carlos Bustamante Bustamante Lab UPoN 2008, Lyon, June 2-6 2008

2. Outline Introduction Optical tweezers Experiments Model Results Conclusions

3. Outline Introduction Optical tweezers Experiments Model Results Conclusions

4. Structure of DNA 4 different types of complementary bases (A) Adenine (C) Cytosine A - T (G) Guanine C - G (T) Thymine Bases DNA double helix Strands Genetic information • Cell needs access to genetic information • Transcription & translation (syntesis of proteins) • Replication (duplication of DNA) • Both strands of DNA must be separated to get to the bases 4 bases ... ATGCTGCGAAACTTTGGCTGA 64 codons ...ATGCTGCGAAACTTTGGCTGA 20 aminoacids ...MetLeuArgAsnPheGlyStop UNZIPPING Protein Structure, function Watson J. & Crick F. (1953). Nature 171 (4356)

5. Motivation UNZIPPING F F Can we infer the DNA sequence by force? We need a suitable experimental setup to perform DNA unzipping

6. Outline Introduction Optical tweezers Experiments Model Results Conclusions

7. Optical tweezers A focused laser beam produces an optical trap Light is deflected when a force is applied 1mm We can apply and measure forces and distances 0-100 pN0.1 pNresolution 0-10 mm 5 nmresolution Ashkin, A. "Phys. Rev. Lett. 24, 156-159", (1970)

8. Outline Introduction Optical tweezers Experiments Model Results Conclusions

9. Molecule Experimental setup Experimental setup UNZIPPING: Pulling apart both strands of dsDNA from the same end 1mm Bockelmann et. al., Biophys. J.:82:1537-1553 (2002)

10. Force vs. Distance Curves (FDC) • Pulling cycles. Folding-unfolding curves • Force vs. Total distances curves (FDC) • Slow pulling rate (5-25 nm/s). Close-to-equilibrium FDC Raw data Sawtooth-like shape 1 3 Averaged data (Running Average) 2 3 2 1

11. Outline Introduction Optical tweezers Experiments Model Results Conclusions

12. Description of the model Potential energy of the bead in the trap Elastic energy of the handles Elastic energy the released ssDNA Nearest-neighbour (NN) energy of the DNA molecule Bead in the trap – harmonic potential dsDNA – Worm Like Chain ssDNA – Freely Jointed Chain S. Cocco et. al., PNAS:98:8608-8613 (2002)

13. NN model and FDC DNA parameters The energy of DNA determined by the sequence where ei is the energy to open the ith base pair Equilibrium FDC Total energy of the system (energy landscape)

14. Outline Introduction Optical tweezers Experiments Model Results Conclusions

15. Comparison with experiments DNA parameters M-fold is a web server that provides the stacking energies of DNA http://frontend.bioinfo.rpi.edu/zukerm/dna/credit.html J. Santalucia, Jr., PNAS:95:1460-1465 (1998)

16. Correcting the energies • Correction of the 10 DNA stacking energies • Similar values, but corrected up to 10% • Corrections have different signs

17. Detection of intermediate states

18. Detection of intermediate states We want to know the number of open base pairs at each experimental measure. How to detect states in such noise data?

19. Detection of intermediate states All possible states of the system are caracterized by the total distance and the number of open basepairs (xtot, n) xtotis given the point. We select the most probable state(n) for each experimental point. The most probable state is the theoretical state that passes closest to the experimental point.

20. Detection of intermediate states

21. Avalanche analysis

22. Avalanche distribution function Experimentally we cannot see avalanches smaller than 10 base pairs. The sequencing by force is still an experimental challenge.

23. Conclusions • We have inferred DNA thermodynamics using optical tweezers and performing single molecule experiments. • The NN model is useful to extract information about the intermediate states from the experimental noise measurements. • Sequencing DNA by force is not possible yet • Cooperative avalanches (intrinsic mechanism) • Experimental resolution (10 bps)