350 likes | 492 Views
Trumpet leaves and microRNA. Catherine Kidner CSHL. Patterning events happen very early in leaf development. Processes in leaf development. Down regulation of meristem-specific genes. Establishment of axis. Growth and cell differentiation. Stages of leaf development. Arabidopsis thaliana.
E N D
Trumpet leaves and microRNA Catherine Kidner CSHL
Processes in leaf development Down regulation of meristem-specific genes Establishment of axis Growth and cell differentiation
Arabidopsis thaliana flower silque (fruit) lateral shoot cauline leaf 5 Chromosomes 125 Mega bases of DNA First plant genome sequenced (2001) rosette leaf
Patterning events happen very early in leaf development Trichome (hair) Interlocking epidermis Leaf blade expanding Petiole
YABBY (FIL) KANADI STM PHB AS1 Genes involved in leaf development
Mutations in ARGONAUTE1 Cause Developmental Defects Relative size Stem cell defects Organ identity defects Organ polarity defects
Two lab strains Landsberg Columbia Most ‘classical’ mutants Easiest to transform originally Compact, so easy to work with Most new insertion lines Easiest to transform now Full genome sequence
catcgtcggggacttagatgtatatatatcgctgt Dde1 cttag catcgtcggggagttagatgtatatatatcgctgt CAPs markers exploit the variation between the two strains Ler Col-0
Self F1 F2 Plants ago-12/ago1-12 +/+ CAPS mapping
Wild type siblings ago-12 phenotype L/L L/L C/C L/L C/L C/L
The ARGONAUTE family RG-rich PAZ PIWI RG-rich PIWI PAZ Piwi family AGO family
An Allelic Series of ARGONAUTE1 Mutants Strong Medium Weak ago1-12 ago1-11 ago1-9 ago1-10 RG-rich PAZ PIWI RG-rich PAZ PIWI
RISC AGO aaaa RNA interference Centromere function dsRNA siRNA Science 2002 Development PTGS Viral defense
miRNA and the Role of AGO1 AGO1 CAF RISC 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa mRNA degradation
100ng 10ng 1ng 0.1ng ago1-10 ago1-10 ago1-10 ago1-10 WT WT WT WT Genes regulated by AGO1 Total RNA One Step RT-PCR ER No Change AS1 No Change Down in ago AG Down in ago AP1 Up in ago CLF Down in ago FIL KAN1 No Change
ago1-11 ago1-11/ stm-2 ago1-11/ stm-2 AGO1 is required for stem cell function Strong alleles of AGO1 lack shoot apical meristems Weak alleles of STM enhance weak alleles of AGO1 ago1-10
ET2689 ET3964 WT ago WT ago WT ago WT ago ER FIL 100ng 10ng 1ng 0.1ng ago1 has Adaxialised Organs
miRNA Regulation is Required for Stem Cells and Polarity Strong caf alleles are embryo lethal caf-1 (weak) ago1-11 (weak) caf/caf, ago1-11/ago1-11
The HD-ZIP III gene PHABULOSA is Associated with Adaxial Cell Fate Phab1-D/+ WT McConnell et al., 1999, 2001
1kb HD-ZIP III Genes are Targets of miRNA homeo- domain START lipid-sterol binding domain leucine zipper * At REVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHABULOSA 3’ GGCCTGGTCCGAAGTAGG 5’ At PHAVOLUTA 3’ GGCCTGGTCCGAAGTAGG 5’ At miRNA165 5’ CCGGACCAGGCTTCATCC 3’ At miRNA166 5’ CCGGACCAGGCTTCATCC 3’ Reinhard et al., Llave et al., Parks et al., 2002
ago1-10 ago1-11 pnh PHABULOSA caf wt wt wt PHAVOLUTA REVOLUTA TUBULIN RUBISCO HD-ZIP III transcripts accumulate in PAZ mutants 10ng 30ng 60ng
miR165 is Expressed Abaxially in Leaf Primordia miR165 PHB/PHV
miR165 PHB/PHV miR165 is Over and Ectopically Expressed in ago1
miR165 PHB/PHV AGO1 CAF 22nt miRNA miRNA precursor AGO1 AGO1 aaaaaaa mRNA aaaaaaa Adaxialised